Incidental Mutation 'RF034:Cpne1'
ID604478
Institutional Source Beutler Lab
Gene Symbol Cpne1
Ensembl Gene ENSMUSG00000074643
Gene Namecopine I
Synonyms1810028N16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.696) question?
Stock #RF034 (G1)
Quality Score175.458
Status Not validated
Chromosome2
Chromosomal Location156071842-156111965 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TCCAC to TC at 156073510 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000079312] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000132494] [ENSMUST00000136296] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000184265]
AlphaFold Q8C166
Predicted Effect probably benign
Transcript: ENSMUST00000038860
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140109
SMART Domains Protein: ENSMUSP00000121998
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
Pfam:Copine 1 148 2.1e-50 PFAM
Pfam:vWA-TerF-like 5 111 2.5e-7 PFAM
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183733
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Its activity is also upregulated in mouse embryos. This gene and the gene for RNA binding motif protein 12 overlap at map location 2 H2. Two alternatively spliced variants that encode the same isoform have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Cpne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:Cpne1 APN 2 156077643 missense possibly damaging 0.90
IGL02291:Cpne1 APN 2 156078420 missense probably damaging 1.00
IGL02719:Cpne1 APN 2 156078217 missense probably damaging 1.00
IGL03011:Cpne1 APN 2 156077997 missense probably damaging 0.99
IGL03347:Cpne1 APN 2 156079176 missense probably damaging 1.00
johannesburg UTSW 2 156077641 missense probably damaging 1.00
FR4304:Cpne1 UTSW 2 156072025 frame shift probably null
FR4449:Cpne1 UTSW 2 156073502 intron probably benign
FR4976:Cpne1 UTSW 2 156072025 frame shift probably null
R0496:Cpne1 UTSW 2 156079419 missense probably damaging 0.99
R0735:Cpne1 UTSW 2 156078750 critical splice donor site probably null
R0792:Cpne1 UTSW 2 156077419 missense probably benign 0.00
R1874:Cpne1 UTSW 2 156078382 missense probably damaging 0.99
R2015:Cpne1 UTSW 2 156078388 missense probably damaging 1.00
R2518:Cpne1 UTSW 2 156073971 missense probably damaging 0.99
R3000:Cpne1 UTSW 2 156073422 makesense probably null
R3875:Cpne1 UTSW 2 156076282 missense probably damaging 1.00
R5021:Cpne1 UTSW 2 156098273 intron probably benign
R5385:Cpne1 UTSW 2 156074364 missense probably damaging 0.99
R5654:Cpne1 UTSW 2 156077641 missense probably damaging 1.00
R5959:Cpne1 UTSW 2 156078223 missense probably benign 0.00
R6775:Cpne1 UTSW 2 156078420 missense probably damaging 1.00
R7049:Cpne1 UTSW 2 156078807 missense probably damaging 0.97
R7488:Cpne1 UTSW 2 156077937 missense probably benign 0.00
R8212:Cpne1 UTSW 2 156078214 missense probably damaging 0.96
R8332:Cpne1 UTSW 2 156078397 missense probably benign 0.00
R8870:Cpne1 UTSW 2 156078953 missense probably benign 0.30
R8921:Cpne1 UTSW 2 156072045 missense probably benign 0.20
R9094:Cpne1 UTSW 2 156079160 missense probably damaging 0.99
R9095:Cpne1 UTSW 2 156076290 critical splice acceptor site probably null
RF037:Cpne1 UTSW 2 156073510 intron probably benign
RF043:Cpne1 UTSW 2 156073510 intron probably benign
Z1176:Cpne1 UTSW 2 156077644 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCAAGTGTGGCTCTCTC -3'
(R):5'- ACCAGGGAAACTTACAGGCC -3'

Sequencing Primer
(F):5'- CAAGTGTGGCTCTCTCTAGCAG -3'
(R):5'- CCCCTCCCTGATCTCGC -3'
Posted On2019-12-04