Incidental Mutation 'RF034:Tomm5'
ID604481
Institutional Source Beutler Lab
Gene Symbol Tomm5
Ensembl Gene ENSMUSG00000078713
Gene Nametranslocase of outer mitochondrial membrane 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #RF034 (G1)
Quality Score126.467
Status Not validated
Chromosome4
Chromosomal Location45105208-45108114 bp(-) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) TCTTCCGC to TCTTCCGCAGCTTCCGC at 45107976 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107807] [ENSMUST00000107808] [ENSMUST00000107809] [ENSMUST00000107810]
Predicted Effect probably benign
Transcript: ENSMUST00000107807
Predicted Effect probably benign
Transcript: ENSMUST00000107808
SMART Domains Protein: ENSMUSP00000103438
Gene: ENSMUSG00000078713

DomainStartEndE-ValueType
Pfam:TOM_sub5 1 47 9.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107809
SMART Domains Protein: ENSMUSP00000103439
Gene: ENSMUSG00000078713

DomainStartEndE-ValueType
Pfam:TOM_sub5 1 45 2.2e-29 PFAM
low complexity region 88 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107810
SMART Domains Protein: ENSMUSP00000103440
Gene: ENSMUSG00000078713

DomainStartEndE-ValueType
Pfam:TOM_sub5 1 51 9.1e-40 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial neonatal lethality, cryptogenic organizing pneumonia, intra-alveolar fibrosis, diffuse moderate eosinophilic granulocytosis in the bone marrow, and thymus atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Tomm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Tomm5 UTSW 4 45107973 small insertion probably benign
FR4548:Tomm5 UTSW 4 45107977 small insertion probably benign
R1586:Tomm5 UTSW 4 45107915 critical splice donor site probably null
R1867:Tomm5 UTSW 4 45107939 missense probably damaging 0.97
R5428:Tomm5 UTSW 4 45106689 intron probably benign
R5590:Tomm5 UTSW 4 45106679 intron probably benign
R6825:Tomm5 UTSW 4 45106443 splice site probably null
R7793:Tomm5 UTSW 4 45106651 missense unknown
R7946:Tomm5 UTSW 4 45107969 missense probably benign 0.18
RF030:Tomm5 UTSW 4 45107973 small insertion probably benign
RF036:Tomm5 UTSW 4 45107973 small insertion probably benign
RF047:Tomm5 UTSW 4 45107974 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGACTTAACCACGCGTCCTC -3'
(R):5'- ATGAAATTTTCCCCTCACAGGTTC -3'

Sequencing Primer
(F):5'- AGTCCTGGACGTGCAAGCAC -3'
(R):5'- TCACAGGTTCCCGTCACAG -3'
Posted On2019-12-04