Incidental Mutation 'RF034:Pdik1l'
ID 604482
Institutional Source Beutler Lab
Gene Symbol Pdik1l
Ensembl Gene ENSMUSG00000050890
Gene Name PDLIM1 interacting kinase 1 like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF034 (G1)
Quality Score 214.594
Status Not validated
Chromosome 4
Chromosomal Location 134275002-134287895 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TTTT to TTTTGTTTTTGGTTT at 134279374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061234] [ENSMUST00000105876] [ENSMUST00000105877] [ENSMUST00000127857] [ENSMUST00000145006]
AlphaFold Q8QZR7
Predicted Effect probably benign
Transcript: ENSMUST00000061234
SMART Domains Protein: ENSMUSP00000060381
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105876
SMART Domains Protein: ENSMUSP00000101502
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105877
SMART Domains Protein: ENSMUSP00000101503
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 84 184 2.2e-7 PFAM
Pfam:Pkinase 84 402 4.5e-51 PFAM
Pfam:Pkinase_Tyr 185 405 6.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127857
SMART Domains Protein: ENSMUSP00000117719
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase 8 113 3.4e-12 PFAM
Pfam:Pkinase_Tyr 8 136 8.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142504
Predicted Effect probably benign
Transcript: ENSMUST00000145006
SMART Domains Protein: ENSMUSP00000118116
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 185 4.1e-24 PFAM
Pfam:Pkinase 10 187 4.9e-38 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Pdik1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Pdik1l APN 4 134278704 missense probably benign 0.11
FR4304:Pdik1l UTSW 4 134279374 frame shift probably null
FR4340:Pdik1l UTSW 4 134279512 intron probably benign
FR4342:Pdik1l UTSW 4 134279509 intron probably benign
FR4548:Pdik1l UTSW 4 134279512 intron probably benign
FR4589:Pdik1l UTSW 4 134279368 frame shift probably null
FR4589:Pdik1l UTSW 4 134279369 frame shift probably null
FR4737:Pdik1l UTSW 4 134279367 frame shift probably null
FR4737:Pdik1l UTSW 4 134279506 intron probably benign
FR4976:Pdik1l UTSW 4 134279506 intron probably benign
R1867:Pdik1l UTSW 4 134278911 missense probably damaging 1.00
R2106:Pdik1l UTSW 4 134284254 missense probably damaging 1.00
R2303:Pdik1l UTSW 4 134284248 nonsense probably null
R2398:Pdik1l UTSW 4 134278399 missense probably benign 0.01
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R4515:Pdik1l UTSW 4 134278896 missense probably damaging 1.00
R4711:Pdik1l UTSW 4 134278990 missense probably benign 0.15
R5602:Pdik1l UTSW 4 134284269 missense probably damaging 0.99
R5822:Pdik1l UTSW 4 134287163 missense possibly damaging 0.53
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R7517:Pdik1l UTSW 4 134278425 missense possibly damaging 0.83
R7705:Pdik1l UTSW 4 134279493 missense unknown
R8203:Pdik1l UTSW 4 134279365 missense unknown
R8524:Pdik1l UTSW 4 134286610 missense probably benign
RF002:Pdik1l UTSW 4 134279375 frame shift probably null
RF007:Pdik1l UTSW 4 134279368 frame shift probably null
RF008:Pdik1l UTSW 4 134279511 intron probably benign
RF022:Pdik1l UTSW 4 134279367 frame shift probably null
RF025:Pdik1l UTSW 4 134286594 frame shift probably null
RF026:Pdik1l UTSW 4 134286594 intron probably benign
RF030:Pdik1l UTSW 4 134279516 intron probably benign
RF031:Pdik1l UTSW 4 134279374 frame shift probably null
RF035:Pdik1l UTSW 4 134279510 intron probably benign
RF040:Pdik1l UTSW 4 134279515 intron probably benign
RF048:Pdik1l UTSW 4 134279372 frame shift probably null
RF056:Pdik1l UTSW 4 134279502 intron probably benign
RF056:Pdik1l UTSW 4 134279516 intron probably benign
RF057:Pdik1l UTSW 4 134279368 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGTAGTTTAAGATGCACAGAGGTTG -3'
(R):5'- GCAAGCTGCAGATTGACCTAAC -3'

Sequencing Primer
(F):5'- CTGAATTTACTGCTCTCACAGAGGAC -3'
(R):5'- AGCTGCAGATTGACCTAACGTTTTC -3'
Posted On 2019-12-04