Incidental Mutation 'RF034:Acap3'
ID604483
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 3
SynonymsCentb5, Kiaa1716-hp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #RF034 (G1)
Quality Score217.8
Status Not validated
Chromosome4
Chromosomal Location155891822-155907251 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) GCATCCTGGGCTGCT to GCATCCTGGGCTGCTACATCCTGGGCTGCT at 155905092 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5482:Acap3 UTSW 4 155900156 missense probably benign 0.00
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5769:Acap3 UTSW 4 155902400 missense probably damaging 0.99
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF010:Acap3 UTSW 4 155905096 small insertion probably benign
RF013:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF038:Acap3 UTSW 4 155905092 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATGGCAGTTCAGATGTTC -3'
(R):5'- TTTCATATAAGCCCTGCCTGTG -3'

Sequencing Primer
(F):5'- AGTGGTGGACAGTGTCACC -3'
(R):5'- TGTGCTCACCCCTAGTACAG -3'
Posted On2019-12-04