Incidental Mutation 'RF034:Rassf6'
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #RF034 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationutr 3 prime
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90631532 missense possibly damaging 0.83
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04