Incidental Mutation 'RF034:Tmed6'
ID 604494
Institutional Source Beutler Lab
Gene Symbol Tmed6
Ensembl Gene ENSMUSG00000031919
Gene Name transmembrane p24 trafficking protein 6
Synonyms 1810018I24Rik, 1810015P03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF034 (G1)
Quality Score 214.458
Status Not validated
Chromosome 8
Chromosomal Location 107061476-107065644 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) AGC to AGCTGGC at 107061596 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034391] [ENSMUST00000034392] [ENSMUST00000034393] [ENSMUST00000095517] [ENSMUST00000170962]
AlphaFold Q9CQG0
Predicted Effect probably benign
Transcript: ENSMUST00000034391
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034392
SMART Domains Protein: ENSMUSP00000034392
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PUA 95 170 4.36e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034393
SMART Domains Protein: ENSMUSP00000034393
Gene: ENSMUSG00000031919

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EMP24_GP25L 43 228 1.87e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095517
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170962
SMART Domains Protein: ENSMUSP00000126153
Gene: ENSMUSG00000031917

DomainStartEndE-ValueType
PDB:1T5Y|A 1 133 7e-87 PDB
Blast:PUA 95 123 5e-13 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Tmed6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02447:Tmed6 APN 8 107065608 missense possibly damaging 0.85
FR4589:Tmed6 UTSW 8 107061598 nonsense probably null
R0077:Tmed6 UTSW 8 107065566 missense probably damaging 0.98
R0653:Tmed6 UTSW 8 107065651 splice site probably null
R0718:Tmed6 UTSW 8 107061724 missense probably damaging 1.00
R0750:Tmed6 UTSW 8 107061769 missense possibly damaging 0.87
R1497:Tmed6 UTSW 8 107064122 missense probably benign 0.05
R3016:Tmed6 UTSW 8 107065437 missense probably damaging 1.00
R4589:Tmed6 UTSW 8 107064161 missense probably benign 0.31
R4754:Tmed6 UTSW 8 107063730 missense probably damaging 0.99
R5860:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5861:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5862:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R5941:Tmed6 UTSW 8 107064154 missense probably damaging 1.00
R6177:Tmed6 UTSW 8 107065451 missense probably damaging 0.98
R6225:Tmed6 UTSW 8 107061739 missense probably damaging 0.98
R8869:Tmed6 UTSW 8 107065532 missense probably damaging 0.98
R9042:Tmed6 UTSW 8 107063753 missense probably benign 0.39
R9183:Tmed6 UTSW 8 107061758 nonsense probably null
RF043:Tmed6 UTSW 8 107061596 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACAGCTGGATAAAGATGTTTCTAG -3'
(R):5'- CGCTTCTACAACTATGCCAGG -3'

Sequencing Primer
(F):5'- GTCTACCCGGCAAGTTCTAGTAG -3'
(R):5'- GCTTCTACAACTATGCCAGGATGAG -3'
Posted On 2019-12-04