Incidental Mutation 'RF034:Neu1'
ID 604501
Institutional Source Beutler Lab
Gene Symbol Neu1
Ensembl Gene ENSMUSG00000007038
Gene Name neuraminidase 1
Synonyms Apl, Neu-1, sialidase 1, lysosomal sialidase, G9, Map-2, Bat-7, Bat7, Aglp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF034 (G1)
Quality Score 214.459
Status Not validated
Chromosome 17
Chromosomal Location 34931253-34935953 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) TCTTCTA to T at 34932558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000007253] [ENSMUST00000169230]
AlphaFold O35657
Predicted Effect probably benign
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007253
SMART Domains Protein: ENSMUSP00000007253
Gene: ENSMUSG00000007038

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:BNR_3 74 249 1e-16 PFAM
Pfam:BNR_2 82 377 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169230
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174715
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice develop features of early-onset lysosomal storage disease (sialidosis), including severe nephropathy, edema, splenomegaly, kyphosis and oligosacchariduria, and display myoclonus, lordosis, extramedullary hematopoiesis, dyspnea, weight loss, gait defects, tremors and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Neu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Neu1 APN 17 34934716 missense probably benign 0.34
IGL02197:Neu1 APN 17 34934665 missense possibly damaging 0.92
IGL02442:Neu1 APN 17 34934469 missense probably benign
IGL02545:Neu1 APN 17 34931501 missense probably benign 0.41
FR4340:Neu1 UTSW 17 34932558 unclassified probably benign
R0331:Neu1 UTSW 17 34934170 missense possibly damaging 0.62
R0508:Neu1 UTSW 17 34932784 missense probably benign 0.07
R0646:Neu1 UTSW 17 34934760 missense probably damaging 1.00
R0683:Neu1 UTSW 17 34934325 splice site probably null
R1300:Neu1 UTSW 17 34934338 missense possibly damaging 0.87
R1545:Neu1 UTSW 17 34934398 missense probably benign 0.00
R1552:Neu1 UTSW 17 34932113 unclassified probably benign
R2107:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2108:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2279:Neu1 UTSW 17 34934374 missense probably damaging 1.00
R2291:Neu1 UTSW 17 34932766 missense probably damaging 1.00
R2895:Neu1 UTSW 17 34932782 missense probably benign 0.08
R4747:Neu1 UTSW 17 34934383 missense possibly damaging 0.77
R6010:Neu1 UTSW 17 34932055 missense probably damaging 1.00
R6122:Neu1 UTSW 17 34934754 missense probably benign 0.00
R8490:Neu1 UTSW 17 34932006 missense probably benign 0.00
R9257:Neu1 UTSW 17 34931420 missense probably benign 0.00
RF045:Neu1 UTSW 17 34932558 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAAACCAGAGGATGAATTTTGTCC -3'
(R):5'- AGGAAATGCCGTCGTCCTTAC -3'

Sequencing Primer
(F):5'- AGGATGAATTTTGTCCATAGTTTCTG -3'
(R):5'- GTCGTCCTTACTCCAAACCAACATG -3'
Posted On 2019-12-04