Incidental Mutation 'RF034:Mamld1'
ID 604507
Institutional Source Beutler Lab
Gene Symbol Mamld1
Ensembl Gene ENSMUSG00000059401
Gene Name mastermind-like domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF034 (G1)
Quality Score 191.468
Status Not validated
Chromosome X
Chromosomal Location 71050256-71156056 bp(+) (GRCm38)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCGGC at 71118835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082088] [ENSMUST00000114629]
AlphaFold P0C6A2
Predicted Effect probably benign
Transcript: ENSMUST00000082088
SMART Domains Protein: ENSMUSP00000080737
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 3.74e-7 PROSPERO
internal_repeat_1 418 466 3.74e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114629
SMART Domains Protein: ENSMUSP00000110276
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 2.31e-7 PROSPERO
internal_repeat_1 418 466 2.31e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice exhibit normal male genitalia and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Mamld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Mamld1 APN X 71118652 missense possibly damaging 0.93
FR4340:Mamld1 UTSW X 71118846 small insertion probably benign
FR4737:Mamld1 UTSW X 71118835 small insertion probably benign
FR4737:Mamld1 UTSW X 71118839 small insertion probably benign
FR4976:Mamld1 UTSW X 71118812 small insertion probably benign
FR4976:Mamld1 UTSW X 71118818 small insertion probably benign
R2133:Mamld1 UTSW X 71119392 missense probably benign 0.00
R2277:Mamld1 UTSW X 71118815 small deletion probably benign
RF003:Mamld1 UTSW X 71118820 small insertion probably benign
RF004:Mamld1 UTSW X 71118831 nonsense probably null
RF014:Mamld1 UTSW X 71118845 small insertion probably benign
RF015:Mamld1 UTSW X 71118820 small insertion probably benign
RF015:Mamld1 UTSW X 71118841 small insertion probably benign
RF018:Mamld1 UTSW X 71118849 small insertion probably benign
RF022:Mamld1 UTSW X 71118820 small insertion probably benign
RF025:Mamld1 UTSW X 71118826 small insertion probably benign
RF030:Mamld1 UTSW X 71118828 nonsense probably null
RF033:Mamld1 UTSW X 71118833 small insertion probably benign
RF035:Mamld1 UTSW X 71118812 small insertion probably benign
RF035:Mamld1 UTSW X 71118838 small insertion probably benign
RF035:Mamld1 UTSW X 71118850 small insertion probably benign
RF036:Mamld1 UTSW X 71118828 small insertion probably benign
RF036:Mamld1 UTSW X 71118835 small insertion probably benign
RF036:Mamld1 UTSW X 71118840 small insertion probably benign
RF038:Mamld1 UTSW X 71118846 small insertion probably benign
RF039:Mamld1 UTSW X 71118826 small insertion probably benign
RF039:Mamld1 UTSW X 71118840 small insertion probably benign
RF040:Mamld1 UTSW X 71118814 small insertion probably benign
RF041:Mamld1 UTSW X 71118826 small insertion probably benign
RF041:Mamld1 UTSW X 71118829 small insertion probably benign
RF042:Mamld1 UTSW X 71118812 small insertion probably benign
RF042:Mamld1 UTSW X 71118853 small insertion probably benign
RF043:Mamld1 UTSW X 71118835 small insertion probably benign
RF047:Mamld1 UTSW X 71118839 small insertion probably benign
RF048:Mamld1 UTSW X 71118852 nonsense probably null
RF049:Mamld1 UTSW X 71118833 small insertion probably benign
RF049:Mamld1 UTSW X 71118845 small insertion probably benign
RF053:Mamld1 UTSW X 71118852 small insertion probably benign
RF055:Mamld1 UTSW X 71118837 small insertion probably benign
RF059:Mamld1 UTSW X 71118832 small insertion probably benign
RF060:Mamld1 UTSW X 71118831 nonsense probably null
RF060:Mamld1 UTSW X 71118832 small insertion probably benign
RF061:Mamld1 UTSW X 71118850 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCAATCTGGTGTCCTCTAGTG -3'
(R):5'- AATGTGACAAGGGCTTGGTG -3'

Sequencing Primer
(F):5'- AAGGACACCTGATATCTGCTCTG -3'
(R):5'- GTTGCTGAAGGTAAAGGGCTC -3'
Posted On 2019-12-04