Incidental Mutation 'RF034:Gabre'
ID 604508
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF034 (G1)
Quality Score 214.492
Status Not validated
Chromosome X
Chromosomal Location 72255999-72274803 bp(-) (GRCm38)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCTC to GCTCTGTCTC at 72270762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
AlphaFold A2AMW3
Predicted Effect probably benign
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 72274653 nonsense probably null
FR4304:Gabre UTSW X 72270042 small insertion probably benign
FR4589:Gabre UTSW X 72270030 small insertion probably benign
FR4589:Gabre UTSW X 72270042 small insertion probably benign
FR4976:Gabre UTSW X 72270418 small insertion probably benign
FR4976:Gabre UTSW X 72270422 small insertion probably benign
R7620:Gabre UTSW X 72270259 missense unknown
RF002:Gabre UTSW X 72270057 nonsense probably null
RF005:Gabre UTSW X 72270045 nonsense probably null
RF009:Gabre UTSW X 72270712 small deletion probably benign
RF009:Gabre UTSW X 72270713 small insertion probably benign
RF010:Gabre UTSW X 72270060 small insertion probably benign
RF013:Gabre UTSW X 72270416 small insertion probably benign
RF023:Gabre UTSW X 72270054 small insertion probably benign
RF024:Gabre UTSW X 72270177 frame shift probably null
RF028:Gabre UTSW X 72270763 small insertion probably benign
RF029:Gabre UTSW X 72270059 small insertion probably benign
RF037:Gabre UTSW X 72270061 small insertion probably benign
RF041:Gabre UTSW X 72270049 small insertion probably benign
RF042:Gabre UTSW X 72270047 small insertion probably benign
RF043:Gabre UTSW X 72270048 small insertion probably benign
RF044:Gabre UTSW X 72270061 small insertion probably benign
RF045:Gabre UTSW X 72270045 small insertion probably benign
RF045:Gabre UTSW X 72270181 frame shift probably null
RF047:Gabre UTSW X 72270053 small insertion probably benign
RF047:Gabre UTSW X 72270765 nonsense probably null
RF049:Gabre UTSW X 72270277 frame shift probably null
RF050:Gabre UTSW X 72270741 nonsense probably null
RF051:Gabre UTSW X 72270049 small insertion probably benign
RF052:Gabre UTSW X 72270047 small insertion probably benign
RF054:Gabre UTSW X 72270416 small insertion probably benign
RF055:Gabre UTSW X 72270177 frame shift probably null
RF058:Gabre UTSW X 72270063 small insertion probably benign
RF059:Gabre UTSW X 72270764 small insertion probably benign
RF061:Gabre UTSW X 72270048 small insertion probably benign
RF064:Gabre UTSW X 72270063 nonsense probably null
RF064:Gabre UTSW X 72270171 frame shift probably null
X0018:Gabre UTSW X 72270338 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCAGGCTGAGGTCTGGGTC -3'
(R):5'- TGCCCAAGATAAGGTAGTCTTTGG -3'

Sequencing Primer
(F):5'- CTCAGGTTGGGGTTCAGGC -3'
(R):5'- AATCCCCTGGCCATGATGATGTAG -3'
Posted On 2019-12-04