Incidental Mutation 'RF035:Gm10521'
ID604513
Institutional Source Beutler Lab
Gene Symbol Gm10521
Ensembl Gene ENSMUSG00000073492
Gene Namepredicted gene 10521
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #RF035 (G1)
Quality Score214.458
Status Not validated
Chromosome1
Chromosomal Location171895664-171898237 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTCTCTCTCT to CTCTCTCTCTCTCT at 171896293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097466]
Predicted Effect probably null
Transcript: ENSMUST00000097466
SMART Domains Protein: ENSMUSP00000095074
Gene: ENSMUSG00000073492

DomainStartEndE-ValueType
low complexity region 28 98 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Gm10521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Gm10521 APN 1 171896443 missense unknown
IGL01791:Gm10521 APN 1 171896397 missense unknown
R3752:Gm10521 UTSW 1 171896145 missense unknown
R5477:Gm10521 UTSW 1 171896500 missense unknown
R5907:Gm10521 UTSW 1 171896503 missense unknown
R8036:Gm10521 UTSW 1 171896185 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGTGATTCCACTAGGCTC -3'
(R):5'- CCTCTGAGAAATCATGCCATGTAAC -3'

Sequencing Primer
(F):5'- CAGGGACCTAACAATGGCTTATGTC -3'
(R):5'- TGCCATGTAACAAATATGGTGTGAG -3'
Posted On2019-12-04