Incidental Mutation 'RF035:Tmem59'
ID604522
Institutional Source Beutler Lab
Gene Symbol Tmem59
Ensembl Gene ENSMUSG00000028618
Gene Nametransmembrane protein 59
Synonyms3110046P06Rik, thymic dendritic cell-derived factor 1, D4Ertd20e, 1110001M20Rik, MTDCF1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #RF035 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location107178399-107200996 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to TGTTTGTTG at 107190532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030361] [ENSMUST00000106753] [ENSMUST00000128123] [ENSMUST00000154007]
Predicted Effect probably benign
Transcript: ENSMUST00000030361
SMART Domains Protein: ENSMUSP00000030361
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:BSMAP 72 256 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106753
SMART Domains Protein: ENSMUSP00000102364
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 32 189 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128123
SMART Domains Protein: ENSMUSP00000120288
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 18 127 1.7e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154007
SMART Domains Protein: ENSMUSP00000119701
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein shown to regulate autophagy in response to bacterial infection. This protein may also regulate the retention of amyloid precursor protein (APP) in the Golgi apparatus through its control of APP glycosylation. Overexpression of this protein has been found to promote apoptosis in a glioma cell line. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele display reduced dendritic arborization, reduced miniature excitatory postsynaptic currents, and impaired memory formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Tmem59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02663:Tmem59 APN 4 107197541 missense probably damaging 1.00
IGL02695:Tmem59 APN 4 107193314 missense probably benign 0.00
IGL02699:Tmem59 APN 4 107192538 missense probably benign 0.01
IGL02937:Tmem59 APN 4 107197585 missense probably damaging 1.00
R0945:Tmem59 UTSW 4 107187725 splice site probably benign
R2080:Tmem59 UTSW 4 107178774 missense probably damaging 0.99
R4621:Tmem59 UTSW 4 107190718 intron probably benign
R4622:Tmem59 UTSW 4 107190718 intron probably benign
R4623:Tmem59 UTSW 4 107190718 intron probably benign
R4819:Tmem59 UTSW 4 107187681 nonsense probably null
R5413:Tmem59 UTSW 4 107200462 missense probably benign 0.00
R5866:Tmem59 UTSW 4 107190557 missense probably damaging 0.99
R6073:Tmem59 UTSW 4 107193401 unclassified probably null
RF031:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF033:Tmem59 UTSW 4 107190528 critical splice acceptor site probably benign
RF040:Tmem59 UTSW 4 107190526 critical splice acceptor site probably benign
RF041:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF044:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF060:Tmem59 UTSW 4 107190526 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGGGTACTCAAATTCACC -3'
(R):5'- GGTTCTATGCCAAGACCCTC -3'

Sequencing Primer
(F):5'- GGTACTCAAATTCACCAAACACTTTC -3'
(R):5'- GTTCTATGCCAAGACCCTCATGTAAG -3'
Posted On2019-12-04