Incidental Mutation 'RF035:Zfp933'
ID604524
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Namezinc finger protein 933
Synonyms2810408P10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #RF035 (G1)
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location147822986-147848366 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TT to TTTGCGT at 147825731 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
Predicted Effect probably null
Transcript: ENSMUST00000105718
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147826321 missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147828711 missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147825729 frame shift probably null
FR4548:Zfp933 UTSW 4 147825731 frame shift probably null
R0388:Zfp933 UTSW 4 147826442 missense probably benign 0.35
R0523:Zfp933 UTSW 4 147826462 nonsense probably null
R0539:Zfp933 UTSW 4 147826548 missense probably benign 0.08
R1672:Zfp933 UTSW 4 147826019 missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147826512 missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147826435 nonsense probably null
R5133:Zfp933 UTSW 4 147826864 missense probably benign
R5786:Zfp933 UTSW 4 147828407 splice site probably null
R5891:Zfp933 UTSW 4 147826774 missense probably benign 0.03
R6111:Zfp933 UTSW 4 147828760 missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147825868 missense probably benign 0.07
R6968:Zfp933 UTSW 4 147826197 missense probably damaging 1.00
R7195:Zfp933 UTSW 4 147826179 missense probably benign 0.16
R7555:Zfp933 UTSW 4 147826132 missense probably damaging 1.00
R7902:Zfp933 UTSW 4 147826601 missense probably damaging 0.96
R8319:Zfp933 UTSW 4 147828453 missense possibly damaging 0.87
RF024:Zfp933 UTSW 4 147826441 missense probably damaging 1.00
RF028:Zfp933 UTSW 4 147825731 frame shift probably null
RF043:Zfp933 UTSW 4 147825731 frame shift probably null
V7581:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7582:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAGTCATAGACTTCCTTCCGTAG -3'
(R):5'- ACACATACTGGAGAGAAACCTTATG -3'

Sequencing Primer
(F):5'- TCAACGACTACTGGGATCTGCAG -3'
(R):5'- TGTATGTAATCAATGTGGTAAAGCC -3'
Posted On2019-12-04