Incidental Mutation 'RF035:Srpk2'
ID604526
Institutional Source Beutler Lab
Gene Symbol Srpk2
Ensembl Gene ENSMUSG00000062604
Gene Nameserine/arginine-rich protein specific kinase 2
SynonymsWBP6, mSRPK2
Accession Numbers

NCBI RefSeq: NM_009274.2; MGI:1201408

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF035 (G1)
Quality Score143.457
Status Not validated
Chromosome5
Chromosomal Location23503264-23684617 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) ATCCT to AT at 23525575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000196388] [ENSMUST00000196929]
Predicted Effect probably benign
Transcript: ENSMUST00000088392
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196388
SMART Domains Protein: ENSMUSP00000143453
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
S_TKc 3 129 7.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(3) Gene trapped(36)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Srpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Srpk2 APN 5 23540379 missense probably benign 0.10
IGL02057:Srpk2 APN 5 23518707 missense probably damaging 0.99
IGL02217:Srpk2 APN 5 23545570 missense probably damaging 1.00
IGL03115:Srpk2 APN 5 23524618 splice site probably null
FR4737:Srpk2 UTSW 5 23545196 splice site probably null
P0008:Srpk2 UTSW 5 23513978 missense probably damaging 1.00
R0142:Srpk2 UTSW 5 23527930 missense probably damaging 0.97
R0462:Srpk2 UTSW 5 23518426 missense probably damaging 1.00
R0992:Srpk2 UTSW 5 23545543 missense probably damaging 0.99
R1569:Srpk2 UTSW 5 23514026 missense probably damaging 1.00
R1677:Srpk2 UTSW 5 23525750 splice site probably null
R1696:Srpk2 UTSW 5 23548494 nonsense probably null
R1752:Srpk2 UTSW 5 23528019 missense probably damaging 1.00
R1862:Srpk2 UTSW 5 23524150 missense probably benign 0.32
R1989:Srpk2 UTSW 5 23518423 missense probably damaging 1.00
R2173:Srpk2 UTSW 5 23518615 splice site probably null
R4096:Srpk2 UTSW 5 23540502 intron probably benign
R4271:Srpk2 UTSW 5 23548515 missense possibly damaging 0.95
R4894:Srpk2 UTSW 5 23545529 missense probably damaging 1.00
R5043:Srpk2 UTSW 5 23524517 missense probably benign
R5044:Srpk2 UTSW 5 23524392 missense possibly damaging 0.91
R5309:Srpk2 UTSW 5 23525718 missense probably damaging 0.97
R5478:Srpk2 UTSW 5 23524183 missense possibly damaging 0.71
R5568:Srpk2 UTSW 5 23525699 missense possibly damaging 0.73
R5665:Srpk2 UTSW 5 23518477 missense probably damaging 0.99
R5678:Srpk2 UTSW 5 23524606 frame shift probably null
R6364:Srpk2 UTSW 5 23540467 missense probably damaging 1.00
R7201:Srpk2 UTSW 5 23507628 missense possibly damaging 0.64
R7597:Srpk2 UTSW 5 23548519 missense possibly damaging 0.96
R8251:Srpk2 UTSW 5 23524268 missense probably benign
RF042:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAGCTCAGATGCTCTAAG -3'
(R):5'- ATGGCATCACACTTCCACCTG -3'

Sequencing Primer
(F):5'- CAGATGCTCTAAGGCACTCTGTG -3'
(R):5'- CACTTTCTTACCATGTTGTAGATAGG -3'
Posted On2019-12-04