Incidental Mutation 'RF035:Eps8'
ID604529
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Nameepidermal growth factor receptor pathway substrate 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #RF035 (G1)
Quality Score218.257
Status Not validated
Chromosome6
Chromosomal Location137477245-137654876 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CTCAG at 137517070 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000052776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000147526]
PDB Structure
THE SH3 DOMAIN OF EPS8 EXISTS AS A NOVEL INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 DOMAIN INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 CLOSED MONOMER [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000058210
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably null
Transcript: ENSMUST00000100841
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably null
Transcript: ENSMUST00000111878
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably null
Transcript: ENSMUST00000132920
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000147526
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137505479 missense probably benign 0.00
IGL00499:Eps8 APN 6 137522888 nonsense probably null
IGL01587:Eps8 APN 6 137514713 missense probably damaging 1.00
IGL01789:Eps8 APN 6 137539366 missense probably benign 0.01
IGL01836:Eps8 APN 6 137483541 critical splice donor site probably null
IGL01951:Eps8 APN 6 137537671 missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137522842 missense probably benign 0.05
IGL02546:Eps8 APN 6 137479066 missense probably benign 0.30
IGL02861:Eps8 APN 6 137499599 missense probably damaging 1.00
IGL03115:Eps8 APN 6 137527381 missense probably damaging 1.00
IGL03355:Eps8 APN 6 137512145 splice site probably benign
FR4589:Eps8 UTSW 6 137517069 frame shift probably null
R0113:Eps8 UTSW 6 137537684 missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137479128 missense probably benign 0.01
R0462:Eps8 UTSW 6 137514311 missense probably benign 0.00
R0905:Eps8 UTSW 6 137514307 missense probably benign 0.23
R1106:Eps8 UTSW 6 137514324 missense probably damaging 1.00
R1178:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137500618 missense probably benign 0.00
R1835:Eps8 UTSW 6 137522279 nonsense probably null
R2068:Eps8 UTSW 6 137522174 missense probably benign 0.13
R2113:Eps8 UTSW 6 137537635 unclassified probably null
R2943:Eps8 UTSW 6 137522872 missense probably damaging 1.00
R3032:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R3879:Eps8 UTSW 6 137527362 splice site probably benign
R3973:Eps8 UTSW 6 137509155 missense probably benign 0.00
R4199:Eps8 UTSW 6 137514327 missense probably damaging 0.96
R4384:Eps8 UTSW 6 137499592 missense probably benign 0.30
R4728:Eps8 UTSW 6 137509162 nonsense probably null
R4840:Eps8 UTSW 6 137527130 missense probably damaging 1.00
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4864:Eps8 UTSW 6 137478969 utr 3 prime probably benign
R5197:Eps8 UTSW 6 137490290 missense probably damaging 0.97
R5197:Eps8 UTSW 6 137490291 missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137527492 missense probably damaging 0.99
R5457:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R5464:Eps8 UTSW 6 137527475 missense probably damaging 1.00
R5557:Eps8 UTSW 6 137479096 missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137482210 missense probably damaging 0.98
R6150:Eps8 UTSW 6 137517174 missense probably damaging 1.00
R6473:Eps8 UTSW 6 137479098 missense probably damaging 1.00
R6529:Eps8 UTSW 6 137514337 missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137483598 nonsense probably null
R6890:Eps8 UTSW 6 137512257 missense probably damaging 0.99
R7180:Eps8 UTSW 6 137479074 missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137539356 missense probably benign
R7314:Eps8 UTSW 6 137527092 missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137509213 missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137499587 missense probably benign 0.01
R7942:Eps8 UTSW 6 137530577 missense possibly damaging 0.53
R7988:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7989:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7991:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R8235:Eps8 UTSW 6 137483578 missense possibly damaging 0.62
R8262:Eps8 UTSW 6 137482254 missense probably benign 0.10
RF025:Eps8 UTSW 6 137517066 critical splice donor site probably benign
RF028:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF039:Eps8 UTSW 6 137517070 frame shift probably null
RF046:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF057:Eps8 UTSW 6 137517064 critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137499581 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCTTACTCACCTGCAGTCTG -3'
(R):5'- CAGCTAGAACCAAATTACTTATGCC -3'

Sequencing Primer
(F):5'- TCAAGAGCAAGGAAGCCCC -3'
(R):5'- CCAAATTACTTATGCCTTTGTTTCAC -3'
Posted On2019-12-04