Incidental Mutation 'R0628:Zic2'
ID 60453
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Name zinc finger protein of the cerebellum 2
Synonyms odd-paired homolog, GENA 29, Ku
MMRRC Submission 038817-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R0628 (G1)
Quality Score 125
Status Validated
Chromosome 14
Chromosomal Location 122712847-122717264 bp(+) (GRCm39)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075888
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 A C 18: 65,440,367 (GRCm39) V809G possibly damaging Het
Bank1 T A 3: 135,772,151 (GRCm39) D493V probably damaging Het
Camk2d T C 3: 126,604,273 (GRCm39) probably benign Het
Ccdc17 T A 4: 116,455,745 (GRCm39) L292H probably damaging Het
Ccdc7b A G 8: 129,837,498 (GRCm39) probably benign Het
Cd34 C A 1: 194,641,525 (GRCm39) T317K probably damaging Het
Col6a5 C G 9: 105,789,649 (GRCm39) probably null Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Copa T C 1: 171,918,592 (GRCm39) probably benign Het
Coq7 T C 7: 118,128,867 (GRCm39) D56G probably damaging Het
Dlg4 C T 11: 69,922,610 (GRCm39) T201I probably damaging Het
Dnah7a T A 1: 53,536,264 (GRCm39) D2593V probably benign Het
Ect2l T A 10: 18,018,788 (GRCm39) E536V probably damaging Het
Emilin3 A G 2: 160,752,799 (GRCm39) probably benign Het
Eml2 T C 7: 18,935,479 (GRCm39) probably benign Het
Fam135b C T 15: 71,320,505 (GRCm39) probably benign Het
Fhip2b T C 14: 70,825,161 (GRCm39) T392A possibly damaging Het
Gart C T 16: 91,430,790 (GRCm39) R424H probably benign Het
Gramd1a A G 7: 30,842,049 (GRCm39) L80P probably damaging Het
Herc1 A G 9: 66,358,163 (GRCm39) K2415E probably benign Het
Ica1 C T 6: 8,644,256 (GRCm39) probably benign Het
Idi2l T A 13: 8,990,958 (GRCm39) probably benign Het
Iyd A T 10: 3,497,127 (GRCm39) M161L probably damaging Het
Kdm5a T C 6: 120,392,200 (GRCm39) L974S probably damaging Het
Kif1a T C 1: 92,947,605 (GRCm39) D1619G probably damaging Het
Lypd8 C T 11: 58,275,499 (GRCm39) T78M probably damaging Het
Marchf10 T A 11: 105,280,986 (GRCm39) H433L probably benign Het
Mbp A G 18: 82,572,742 (GRCm39) Y13C probably damaging Het
Mertk A T 2: 128,580,233 (GRCm39) N229I probably damaging Het
Msrb2 T A 2: 19,398,091 (GRCm39) D116E probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Otoa G A 7: 120,744,873 (GRCm39) probably benign Het
Pclo A G 5: 14,719,552 (GRCm39) T1230A unknown Het
Polrmt T C 10: 79,574,979 (GRCm39) T851A possibly damaging Het
Prpf6 C T 2: 181,277,841 (GRCm39) P401L probably damaging Het
Rasgrp4 A G 7: 28,839,635 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,272,064 (GRCm39) probably benign Het
Reps1 A G 10: 17,996,841 (GRCm39) T588A probably damaging Het
Rtel1 A C 2: 180,993,674 (GRCm39) S782R probably benign Het
Sacm1l A G 9: 123,378,060 (GRCm39) probably benign Het
Skic3 G C 13: 76,298,848 (GRCm39) V1185L possibly damaging Het
Skint5 A T 4: 113,588,266 (GRCm39) L728* probably null Het
Slc9b2 T A 3: 135,029,536 (GRCm39) probably benign Het
Snapc3 A T 4: 83,368,397 (GRCm39) H298L probably benign Het
Tex9 A T 9: 72,399,233 (GRCm39) M1K probably null Het
Trappc13 C T 13: 104,291,424 (GRCm39) probably benign Het
Usp3 C T 9: 66,425,726 (GRCm39) R467H probably benign Het
Vmn2r11 T A 5: 109,195,597 (GRCm39) L576F possibly damaging Het
Wnk4 T C 11: 101,165,849 (GRCm39) F792S probably benign Het
Zfp1007 T C 5: 109,826,442 (GRCm39) probably null Het
Zfp280d T C 9: 72,269,230 (GRCm39) V764A probably benign Het
Zfp69 G A 4: 120,806,622 (GRCm39) Q4* probably null Het
Zfp692 T G 11: 58,200,449 (GRCm39) L206R probably damaging Het
Zic4 T A 9: 91,266,170 (GRCm39) Y264* probably null Het
Zic4 T A 9: 91,266,172 (GRCm39) M272K probably benign Het
Zscan4b A T 7: 10,635,390 (GRCm39) N284K probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122,715,971 (GRCm39) nonsense probably null
IGL01607:Zic2 APN 14 122,716,294 (GRCm39) splice site probably benign
IGL02307:Zic2 APN 14 122,714,046 (GRCm39) missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122,713,606 (GRCm39) missense probably damaging 0.99
IGL02561:Zic2 APN 14 122,715,957 (GRCm39) nonsense probably null
IGL02982:Zic2 APN 14 122,715,979 (GRCm39) missense probably damaging 0.98
R0001:Zic2 UTSW 14 122,716,369 (GRCm39) missense probably damaging 0.99
R0027:Zic2 UTSW 14 122,713,755 (GRCm39) missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122,713,953 (GRCm39) missense probably damaging 0.96
R0310:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0418:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0420:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0421:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0518:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0520:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0521:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R1733:Zic2 UTSW 14 122,716,359 (GRCm39) missense probably damaging 0.97
R1757:Zic2 UTSW 14 122,716,031 (GRCm39) missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122,716,329 (GRCm39) nonsense probably null
R5323:Zic2 UTSW 14 122,713,728 (GRCm39) missense probably damaging 1.00
R5381:Zic2 UTSW 14 122,713,227 (GRCm39) missense probably damaging 0.97
R6930:Zic2 UTSW 14 122,713,869 (GRCm39) missense probably damaging 0.99
R7223:Zic2 UTSW 14 122,713,503 (GRCm39) missense probably damaging 0.98
R8750:Zic2 UTSW 14 122,714,129 (GRCm39) missense probably benign 0.06
R8852:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
R8860:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
Z1088:Zic2 UTSW 14 122,716,087 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACGTGCTCAATGGGCAAATG -3'
(R):5'- AAAACAAGCCCTGGCTGTCCTG -3'

Sequencing Primer
(F):5'- AATACCGCCAAGTGGCCAG -3'
(R):5'- cacacacacacacacacac -3'
Posted On 2013-07-11