Incidental Mutation 'RF035:Olfr331'
ID604538
Institutional Source Beutler Lab
Gene Symbol Olfr331
Ensembl Gene ENSMUSG00000058807
Gene Nameolfactory receptor 331
SynonymsGA_x6K02T2NKPP-912840-913784, MOR275-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #RF035 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location58501598-58502572 bp(-) (GRCm38)
Type of Mutationsmall deletion (4 aa in frame mutation)
DNA Base Change (assembly) TGGAGGTGGATTGG to TG at 58502382 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081743] [ENSMUST00000170501]
Predicted Effect probably benign
Transcript: ENSMUST00000081743
SMART Domains Protein: ENSMUSP00000080440
Gene: ENSMUSG00000058807

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1e-42 PFAM
Pfam:7tm_1 45 299 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170501
SMART Domains Protein: ENSMUSP00000132693
Gene: ENSMUSG00000058807

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:7tm_1 39 292 4.9e-28 PFAM
Pfam:7tm_4 141 285 3.6e-42 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Olfr331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Olfr331 APN 11 58502194 missense possibly damaging 0.89
IGL02458:Olfr331 APN 11 58502247 missense probably benign 0.20
IGL02971:Olfr331 APN 11 58502385 missense probably damaging 1.00
IGL03346:Olfr331 APN 11 58501755 missense possibly damaging 0.76
R0416:Olfr331 UTSW 11 58502396 missense unknown
R1547:Olfr331 UTSW 11 58501825 missense probably damaging 1.00
R1697:Olfr331 UTSW 11 58501676 missense probably damaging 1.00
R1717:Olfr331 UTSW 11 58502059 missense probably benign 0.09
R1721:Olfr331 UTSW 11 58501939 missense probably damaging 1.00
R2194:Olfr331 UTSW 11 58501642 missense probably damaging 0.97
R3606:Olfr331 UTSW 11 58502131 missense possibly damaging 0.49
R4457:Olfr331 UTSW 11 58502118 missense probably damaging 1.00
R4766:Olfr331 UTSW 11 58501668 missense probably damaging 1.00
R4858:Olfr331 UTSW 11 58501909 missense probably damaging 1.00
R5475:Olfr331 UTSW 11 58501605 missense probably benign 0.10
R5822:Olfr331 UTSW 11 58501638 missense possibly damaging 0.61
R6337:Olfr331 UTSW 11 58502012 nonsense probably null
R6416:Olfr331 UTSW 11 58502340 missense probably damaging 1.00
R7101:Olfr331 UTSW 11 58502553 missense probably benign 0.00
R7108:Olfr331 UTSW 11 58502554 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTCATAGGACATGGCAG -3'
(R):5'- TCTTGGTTGCCTAGGAGACACC -3'

Sequencing Primer
(F):5'- GCAAGAAGGAAATATTCTGACCCTGC -3'
(R):5'- TTGCCTAGGAGACACCCATGG -3'
Posted On2019-12-04