Incidental Mutation 'RF035:Gucy1b2'
ID604544
Institutional Source Beutler Lab
Gene Symbol Gucy1b2
Ensembl Gene ENSMUSG00000021933
Gene Nameguanylate cyclase 1, soluble, beta 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #RF035 (G1)
Quality Score217.468
Status Not validated
Chromosome14
Chromosomal Location62392676-62456289 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CACACACACACACACACTTAC to CAC at 62408641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022501] [ENSMUST00000165651]
Predicted Effect probably benign
Transcript: ENSMUST00000022501
SMART Domains Protein: ENSMUSP00000022501
Gene: ENSMUSG00000021933

DomainStartEndE-ValueType
Pfam:HNOB 83 244 6e-60 PFAM
Blast:CYCc 263 362 3e-24 BLAST
PDB:4GJ4|D 350 471 4e-8 PDB
CYCc 513 712 1.11e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165651
SMART Domains Protein: ENSMUSP00000128114
Gene: ENSMUSG00000021933

DomainStartEndE-ValueType
Pfam:HNOB 82 250 1.1e-53 PFAM
Blast:CYCc 263 347 6e-25 BLAST
PDB:4GJ4|D 335 456 5e-8 PDB
CYCc 498 697 1.11e-108 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal hyperventilation response to a 10% oxygen environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Gucy1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gucy1b2 APN 14 62406245 missense probably damaging 1.00
IGL00465:Gucy1b2 APN 14 62403200 missense probably benign
IGL00756:Gucy1b2 APN 14 62403209 missense probably benign
IGL01800:Gucy1b2 APN 14 62411655 missense probably benign 0.03
IGL01875:Gucy1b2 APN 14 62420146 missense probably damaging 1.00
IGL03033:Gucy1b2 APN 14 62415944 missense probably benign 0.00
IGL03110:Gucy1b2 APN 14 62433834 splice site probably benign
IGL02796:Gucy1b2 UTSW 14 62407694 missense probably benign 0.42
R0183:Gucy1b2 UTSW 14 62419140 missense probably damaging 1.00
R0605:Gucy1b2 UTSW 14 62403159 splice site probably benign
R0815:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0863:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0972:Gucy1b2 UTSW 14 62408678 missense possibly damaging 0.88
R0972:Gucy1b2 UTSW 14 62414369 missense possibly damaging 0.61
R1438:Gucy1b2 UTSW 14 62414321 missense probably damaging 0.98
R2011:Gucy1b2 UTSW 14 62408758 missense probably damaging 0.99
R2409:Gucy1b2 UTSW 14 62406179 frame shift probably null
R3692:Gucy1b2 UTSW 14 62404627 missense probably damaging 1.00
R4484:Gucy1b2 UTSW 14 62411589 missense possibly damaging 0.88
R4715:Gucy1b2 UTSW 14 62423017 missense possibly damaging 0.95
R4730:Gucy1b2 UTSW 14 62407759 missense probably damaging 1.00
R4812:Gucy1b2 UTSW 14 62415897 splice site probably null
R4839:Gucy1b2 UTSW 14 62448246 missense probably damaging 1.00
R5261:Gucy1b2 UTSW 14 62404579 missense probably damaging 1.00
R5326:Gucy1b2 UTSW 14 62453330 critical splice donor site probably null
R5656:Gucy1b2 UTSW 14 62422981 missense probably damaging 1.00
R5779:Gucy1b2 UTSW 14 62414301 missense possibly damaging 0.82
R6000:Gucy1b2 UTSW 14 62419050 missense probably benign 0.00
R6274:Gucy1b2 UTSW 14 62415939 missense probably damaging 1.00
R7457:Gucy1b2 UTSW 14 62392952 missense probably benign 0.08
R7487:Gucy1b2 UTSW 14 62448223 missense probably damaging 0.97
R7607:Gucy1b2 UTSW 14 62419177 missense probably damaging 1.00
R8030:Gucy1b2 UTSW 14 62392870 missense probably benign
R8285:Gucy1b2 UTSW 14 62420107 missense probably damaging 0.98
R8287:Gucy1b2 UTSW 14 62411816 missense probably damaging 1.00
RF030:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
Z1177:Gucy1b2 UTSW 14 62453453 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAAGATGGGCTTAAGTTCCTC -3'
(R):5'- CTGTTGCAGGAGAATTCGAGAC -3'

Sequencing Primer
(F):5'- TGATTCTAGAAGCAGGCCAC -3'
(R):5'- GAGAATTCGAGACGTGTACCATCC -3'
Posted On2019-12-04