Incidental Mutation 'RF035:E4f1'
Institutional Source Beutler Lab
Gene Symbol E4f1
Ensembl Gene ENSMUSG00000024137
Gene NameE4F transcription factor 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF035 (G1)
Quality Score166.468
Status Not validated
Chromosomal Location24443778-24470313 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CCG to CCGGCG at 24455195 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000056032] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably benign
Transcript: ENSMUST00000056032
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137

low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226654
Predicted Effect probably benign
Transcript: ENSMUST00000226754
Predicted Effect probably benign
Transcript: ENSMUST00000226941
Predicted Effect probably benign
Transcript: ENSMUST00000228882
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display early embryonic lethality with mitotic progression failure and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Chga G GCAT 12: 102,561,427 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in E4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:E4f1 APN 17 24444234 missense probably damaging 0.99
IGL02306:E4f1 APN 17 24446929 missense probably damaging 1.00
IGL03219:E4f1 APN 17 24445445 critical splice donor site probably null
FR4342:E4f1 UTSW 17 24455197 unclassified probably benign
FR4737:E4f1 UTSW 17 24455192 unclassified probably benign
R0084:E4f1 UTSW 17 24444082 missense possibly damaging 0.79
R0179:E4f1 UTSW 17 24451437 missense possibly damaging 0.57
R1171:E4f1 UTSW 17 24451549 missense probably damaging 1.00
R1773:E4f1 UTSW 17 24446584 missense probably damaging 1.00
R4531:E4f1 UTSW 17 24445987 missense possibly damaging 0.56
R5243:E4f1 UTSW 17 24447318 missense probably damaging 1.00
R5430:E4f1 UTSW 17 24444970 missense probably damaging 1.00
R5543:E4f1 UTSW 17 24447362 missense possibly damaging 0.49
R5598:E4f1 UTSW 17 24447129 missense probably damaging 1.00
R5604:E4f1 UTSW 17 24444144 missense probably damaging 1.00
R5858:E4f1 UTSW 17 24445328 missense probably damaging 1.00
R6240:E4f1 UTSW 17 24444582 missense possibly damaging 0.54
R6703:E4f1 UTSW 17 24447131 missense probably damaging 1.00
R7108:E4f1 UTSW 17 24444578 missense probably damaging 0.96
R7122:E4f1 UTSW 17 24444834 nonsense probably null
R7240:E4f1 UTSW 17 24444325 missense probably damaging 1.00
R7604:E4f1 UTSW 17 24455233 missense unknown
R7648:E4f1 UTSW 17 24445448 missense probably benign 0.02
R8357:E4f1 UTSW 17 24446527 missense probably benign 0.39
R8457:E4f1 UTSW 17 24446527 missense probably benign 0.39
R8769:E4f1 UTSW 17 24444600 missense probably damaging 1.00
RF002:E4f1 UTSW 17 24455186 unclassified probably benign
RF011:E4f1 UTSW 17 24455186 unclassified probably benign
RF020:E4f1 UTSW 17 24455195 unclassified probably benign
RF023:E4f1 UTSW 17 24455183 unclassified probably benign
RF028:E4f1 UTSW 17 24455190 unclassified probably benign
RF033:E4f1 UTSW 17 24455183 unclassified probably benign
RF035:E4f1 UTSW 17 24455190 unclassified probably benign
Z1176:E4f1 UTSW 17 24446145 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04