Incidental Mutation 'RF035:AI837181'
ID604555
Institutional Source Beutler Lab
Gene Symbol AI837181
Ensembl Gene ENSMUSG00000047423
Gene Nameexpressed sequence AI837181
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF035 (G1)
Quality Score111.467
Status Not validated
Chromosome19
Chromosomal Location5425157-5427313 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) G to GGCT at 5425238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025853] [ENSMUST00000113673] [ENSMUST00000113674] [ENSMUST00000136579] [ENSMUST00000148219] [ENSMUST00000159759]
Predicted Effect probably benign
Transcript: ENSMUST00000025853
SMART Domains Protein: ENSMUSP00000025853
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 2.1e-8 PFAM
Pfam:CBFD_NFYB_HMF 10 74 1e-20 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113673
SMART Domains Protein: ENSMUSP00000109303
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 6.7e-14 PFAM
Pfam:Histone 1 56 1.8e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113674
SMART Domains Protein: ENSMUSP00000109304
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 10 74 5e-22 PFAM
low complexity region 114 130 N/A INTRINSIC
low complexity region 141 162 N/A INTRINSIC
low complexity region 179 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136579
SMART Domains Protein: ENSMUSP00000133692
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 8.7e-14 PFAM
Pfam:Histone 1 56 2.3e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148219
SMART Domains Protein: ENSMUSP00000121162
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 9.4e-10 PFAM
Pfam:CBFD_NFYB_HMF 10 74 4.5e-22 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159759
SMART Domains Protein: ENSMUSP00000125651
Gene: ENSMUSG00000047423

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
low complexity region 69 82 N/A INTRINSIC
Pfam:DUF1917 139 259 6.1e-19 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in AI837181
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:AI837181 UTSW 19 5425231 small insertion probably benign
FR4548:AI837181 UTSW 19 5425237 small insertion probably benign
FR4976:AI837181 UTSW 19 5425229 small insertion probably benign
R0357:AI837181 UTSW 19 5426703 missense possibly damaging 0.49
R1944:AI837181 UTSW 19 5426229 missense probably damaging 0.96
R4846:AI837181 UTSW 19 5426301 missense probably benign 0.23
R7269:AI837181 UTSW 19 5426434 missense probably damaging 1.00
R7561:AI837181 UTSW 19 5426463 missense probably damaging 1.00
R7761:AI837181 UTSW 19 5426291 missense probably benign 0.03
RF002:AI837181 UTSW 19 5425234 small insertion probably benign
RF002:AI837181 UTSW 19 5425235 small insertion probably benign
RF008:AI837181 UTSW 19 5425238 small insertion probably benign
RF009:AI837181 UTSW 19 5425234 small insertion probably benign
RF011:AI837181 UTSW 19 5425236 small insertion probably benign
RF012:AI837181 UTSW 19 5425227 small insertion probably benign
RF013:AI837181 UTSW 19 5425232 small insertion probably benign
RF021:AI837181 UTSW 19 5425234 small insertion probably benign
RF025:AI837181 UTSW 19 5425226 small insertion probably benign
RF026:AI837181 UTSW 19 5425224 small insertion probably benign
RF030:AI837181 UTSW 19 5425226 small insertion probably benign
RF030:AI837181 UTSW 19 5425235 small insertion probably benign
RF031:AI837181 UTSW 19 5425218 small insertion probably benign
RF033:AI837181 UTSW 19 5425224 small insertion probably benign
RF033:AI837181 UTSW 19 5425237 small insertion probably benign
RF038:AI837181 UTSW 19 5425226 small insertion probably benign
RF038:AI837181 UTSW 19 5425236 small insertion probably benign
RF041:AI837181 UTSW 19 5425229 small insertion probably benign
RF042:AI837181 UTSW 19 5425217 small insertion probably benign
RF042:AI837181 UTSW 19 5425237 small insertion probably benign
RF045:AI837181 UTSW 19 5425218 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTACGAACGTTAGCTCCG -3'
(R):5'- TCGAACCAGATAGGACCAGG -3'

Sequencing Primer
(F):5'- GAACGTTAGCTCCGCCTCC -3'
(R):5'- AGATAGGACCAGGCCTGC -3'
Posted On2019-12-04