Incidental Mutation 'RF035:Amot'
ID604562
Institutional Source Beutler Lab
Gene Symbol Amot
Ensembl Gene ENSMUSG00000041688
Gene Nameangiomotin
SynonymsD0Kist1, E230009N18Rik, Sii6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #RF035 (G1)
Quality Score217.468
Status Not validated
ChromosomeX
Chromosomal Location145446425-145505181 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGAGCAGCAA to G at 145450988 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000112835] [ENSMUST00000112836]
Predicted Effect probably benign
Transcript: ENSMUST00000112835
SMART Domains Protein: ENSMUSP00000108454
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
coiled coil region 20 61 N/A INTRINSIC
internal_repeat_1 75 95 9.29e-5 PROSPERO
low complexity region 140 149 N/A INTRINSIC
low complexity region 175 186 N/A INTRINSIC
Pfam:Angiomotin_C 189 398 1.4e-100 PFAM
low complexity region 426 442 N/A INTRINSIC
SCOP:d1gkub1 513 546 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112836
SMART Domains Protein: ENSMUSP00000108455
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
internal_repeat_1 152 207 2.13e-5 PROSPERO
low complexity region 321 336 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
Blast:PAC 452 493 6e-12 BLAST
low complexity region 529 538 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Pfam:Angiomotin_C 578 785 6.1e-97 PFAM
low complexity region 815 831 N/A INTRINSIC
low complexity region 862 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125271
SMART Domains Protein: ENSMUSP00000116189
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
low complexity region 124 139 N/A INTRINSIC
low complexity region 150 168 N/A INTRINSIC
coiled coil region 211 252 N/A INTRINSIC
Blast:PAC 255 296 6e-12 BLAST
low complexity region 332 341 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Pfam:Angiomotin_C 381 588 2e-97 PFAM
low complexity region 618 634 N/A INTRINSIC
low complexity region 665 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138187
SMART Domains Protein: ENSMUSP00000117777
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
low complexity region 140 155 N/A INTRINSIC
low complexity region 166 184 N/A INTRINSIC
coiled coil region 227 268 N/A INTRINSIC
Blast:PAC 271 312 5e-12 BLAST
low complexity region 348 357 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Pfam:Angiomotin_C 397 604 1.1e-97 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null mutation exhibit impaired migration into proximal extraembryonic regions resulting in furrows of visceral endoderm at the junction of embryonic and extraembryonic regions, vascular insufficiency in the intersomitic region, dilated vessels in the brain and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Amot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Amot APN X 145487028 missense probably damaging 1.00
R1793:Amot UTSW X 145450589 unclassified probably benign
R2426:Amot UTSW X 145476291 missense probably damaging 1.00
R4536:Amot UTSW X 145480142 missense probably benign 0.00
R8229:Amot UTSW X 145450687 unclassified probably benign
RF023:Amot UTSW X 145451003 unclassified probably benign
RF029:Amot UTSW X 145450988 unclassified probably benign
RF050:Amot UTSW X 145451003 unclassified probably benign
Z1177:Amot UTSW X 145480458 missense
Predicted Primers PCR Primer
(F):5'- ATGCAGCAGCTGGAATCTG -3'
(R):5'- AGCACCCAAACTGAACGTGG -3'

Sequencing Primer
(F):5'- CTGGAATCTGAACAGCAGCAGC -3'
(R):5'- CTGAACGTGGACCGGAATC -3'
Posted On2019-12-04