Incidental Mutation 'RF036:Il2'
ID 604570
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF036 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GTGG to GTGGGGCTTGAATTGG at 37179976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,506,701 (GRCm39) probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,989,544 (GRCm39) probably benign Het
Adgra3 GGCCGC GGC 5: 50,215,983 (GRCm39) probably benign Het
Blm CCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCT 7: 80,162,662 (GRCm39) probably null Het
Calhm1 C CTGTGGCTGTGGG 19: 47,129,716 (GRCm39) probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cherp ACCTGGACC AC 8: 73,215,888 (GRCm39) probably null Het
Cherp TGGACC T 8: 73,215,891 (GRCm39) probably null Het
Cyb5r4 CAGACACACTGCC CAGACACACTGCCTAGGGATGTGATAGACACACTGCC 9: 86,922,483 (GRCm39) probably benign Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,503,444 (GRCm39) probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,643,236 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,814,707 (GRCm39) probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,489,142 (GRCm39) probably benign Het
Iqcf4 TCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTT 9: 106,447,810 (GRCm39) probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,479,648 (GRCm39) probably null Het
Kif12 C CCTCCACCCGGCGGGT 4: 63,089,664 (GRCm39) probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,339,381 (GRCm39) probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 28,743,400 (GRCm39) probably null Het
Mamld1 CAG CAGAAG X: 70,162,446 (GRCm39) probably benign Het
Mamld1 CAG CAGGAG X: 70,162,434 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,441 (GRCm39) probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,064,553 (GRCm39) probably null Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,891,048 (GRCm39) probably benign Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,010 (GRCm39) probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,016 (GRCm39) probably benign Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,891,036 (GRCm39) probably benign Het
Nusap1 TTAGCAGTGAGGAGCA TTAGCAGTGAGGAGCACGCTGAGATACACGCTAGCAGTGAGGAGCA 2: 119,458,068 (GRCm39) probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCAGGGAGGAGCAAGCTGAGA 2: 119,458,075 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,300,539 (GRCm39) probably benign Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,756,774 (GRCm39) probably benign Het
Rnf144a TCTCTCTCTC TCTCTCTCTCTCTCTCACTCTCTCTC 12: 26,364,007 (GRCm39) probably benign Het
Rnf144a CTCTC CTCTCTCTCTCTCTCTATCTC 12: 26,364,012 (GRCm39) probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,386,998 (GRCm39) probably null Het
Rsf1 CG CGATG 7: 97,229,115 (GRCm39) probably benign Het
Setd1a GTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,384,472 (GRCm39) probably benign Het
Spmap2l G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,164,276 (GRCm39) probably benign Het
Stat1 G T 1: 52,191,419 (GRCm39) E591D probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCATTACCCCAGTC 17: 78,984,706 (GRCm39) probably null Het
Tcof1 CT CTAGT 18: 60,961,480 (GRCm39) probably benign Het
Tcof1 AGC AGCGGC 18: 60,968,808 (GRCm39) probably benign Het
Tfeb GCA GCACCA 17: 48,097,028 (GRCm39) probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 (GRCm39) probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,673,169 (GRCm39) probably benign Het
Ubtf CTTC CTTCTTC 11: 102,197,771 (GRCm39) probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,000,421 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTTATTAAACACAGCCTTTGGC -3'
(R):5'- TGCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- TTTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2019-12-04