Incidental Mutation 'RF036:Kif12'
ID604573
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Namekinesin family member 12
SynonymsN-9 kinesin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #RF036 (G1)
Quality Score217.496
Status Not validated
Chromosome4
Chromosomal Location63165630-63172131 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) C to CCTCCACCCGGCGGGT at 63171427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
Predicted Effect probably benign
Transcript: ENSMUST00000030042
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect probably benign
Transcript: ENSMUST00000156618
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,287,727 probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,905,087 probably benign Het
Adgra3 GGCCGC GGC 5: 50,058,641 probably benign Het
Blm CCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCT 7: 80,512,914 probably null Het
Calhm1 C CTGTGGCTGTGGG 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,019,870 probably benign Het
Cherp ACCTGGACC AC 8: 72,462,044 probably null Het
Cherp TGGACC T 8: 72,462,047 probably null Het
Cyb5r4 CAGACACACTGCC CAGACACACTGCCTAGGGATGTGATAGACACACTGCC 9: 87,040,430 probably benign Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,812,892 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,984,363 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
Il2 GTGG GTGGGGCTTGAATTGG 3: 37,125,827 probably benign Het
Iqcf4 TCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTT 9: 106,570,611 probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,572,341 probably null Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Mamld1 CAG CAGGAG X: 71,118,828 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,076,114 probably null Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,010 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,016 probably benign Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,941,036 probably benign Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,941,048 probably benign Het
Nusap1 TTAGCAGTGAGGAGCA TTAGCAGTGAGGAGCACGCTGAGATACACGCTAGCAGTGAGGAGCA 2: 119,627,587 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCAGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rnf144a TCTCTCTCTC TCTCTCTCTCTCTCTCACTCTCTCTC 12: 26,314,008 probably benign Het
Rnf144a CTCTC CTCTCTCTCTCTCTCTATCTC 12: 26,314,013 probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,149,541 probably null Het
Rsf1 CG CGATG 7: 97,579,908 probably benign Het
Setd1a GTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,300 probably benign Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 CT CTAGT 18: 60,828,408 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,736 probably benign Het
Tfeb GCA GCACCA 17: 47,786,103 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,016,429 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,089,124 probably benign Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R0927:Kif12 UTSW 4 63168773 missense possibly damaging 0.71
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2372:Kif12 UTSW 4 63168559 missense possibly damaging 0.64
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
RF041:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGGCCAAACGTGAAGAC -3'
(R):5'- GTCCAACTGGAGCAACCTTG -3'

Sequencing Primer
(F):5'- GCCAAACGTGAAGACCGTGC -3'
(R):5'- CAACCTTGCTTTAGGACCCC -3'
Posted On2019-12-04