Incidental Mutation 'RF036:Rassf6'
ID604579
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #RF036 (G1)
Quality Score147.467
Status Not validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TCATGGTCCTGTAGAGCAATGGGGATTC to TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC at 90608915 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,287,727 probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,905,087 probably benign Het
Adgra3 GGCCGC GGC 5: 50,058,641 probably benign Het
Blm CCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCT 7: 80,512,914 probably null Het
Calhm1 C CTGTGGCTGTGGG 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,019,870 probably benign Het
Cherp ACCTGGACC AC 8: 72,462,044 probably null Het
Cherp TGGACC T 8: 72,462,047 probably null Het
Cyb5r4 CAGACACACTGCC CAGACACACTGCCTAGGGATGTGATAGACACACTGCC 9: 87,040,430 probably benign Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,812,892 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,984,363 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
Il2 GTGG GTGGGGCTTGAATTGG 3: 37,125,827 probably benign Het
Iqcf4 TCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTT 9: 106,570,611 probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,572,341 probably null Het
Kif12 C CCTCCACCCGGCGGGT 4: 63,171,427 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Mamld1 CAG CAGGAG X: 71,118,828 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,076,114 probably null Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,010 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,016 probably benign Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,941,036 probably benign Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,941,048 probably benign Het
Nusap1 TTAGCAGTGAGGAGCA TTAGCAGTGAGGAGCACGCTGAGATACACGCTAGCAGTGAGGAGCA 2: 119,627,587 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCAGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Rnf144a TCTCTCTCTC TCTCTCTCTCTCTCTCACTCTCTCTC 12: 26,314,008 probably benign Het
Rnf144a CTCTC CTCTCTCTCTCTCTCTATCTC 12: 26,314,013 probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,149,541 probably null Het
Rsf1 CG CGATG 7: 97,579,908 probably benign Het
Setd1a GTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,300 probably benign Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 CT CTAGT 18: 60,828,408 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,736 probably benign Het
Tfeb GCA GCACCA 17: 47,786,103 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,016,429 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,089,124 probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTAGGCATCTGCTACCG -3'
(R):5'- GCCAGGAAATAGCAGTCATTC -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On2019-12-04