Incidental Mutation 'RF036:Rnf144a'
Institutional Source Beutler Lab
Gene Symbol Rnf144a
Ensembl Gene ENSMUSG00000020642
Gene Namering finger protein 144A
SynonymsUIP4, Rnf144
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF036 (G1)
Quality Score102.467
Status Not validated
Chromosomal Location26300964-26415254 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) CTCTC to CTCTCTCTCTCTCTCTATCTC at 26314013 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020971] [ENSMUST00000062149]
Predicted Effect probably benign
Transcript: ENSMUST00000020971
SMART Domains Protein: ENSMUSP00000020971
Gene: ENSMUSG00000020642

RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062149
SMART Domains Protein: ENSMUSP00000056073
Gene: ENSMUSG00000020642

RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of RING finger domain-containing E3 ubiquitin ligases that also includes parkin and parc. The expression of this gene is induced by DNA damage. The encoded protein interacts with the cytoplasmic DNA-dependent protein kinase, catalytic subunit (DNA-PKcs) and promotes its degradation through ubiquitination. The orthologous mouse protein has been shown to interact with a ubiquitin-conjugating enzyme involved in embryonic development. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,287,727 probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,905,087 probably benign Het
Adgra3 GGCCGC GGC 5: 50,058,641 probably benign Het
Calhm1 C CTGTGGCTGTGGG 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,019,870 probably benign Het
Cherp ACCTGGACC AC 8: 72,462,044 probably null Het
Cherp TGGACC T 8: 72,462,047 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,812,892 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,984,363 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
Il2 GTGG GTGGGGCTTGAATTGG 3: 37,125,827 probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,572,341 probably null Het
Kif12 C CCTCCACCCGGCGGGT 4: 63,171,427 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Mamld1 CAG CAGGAG X: 71,118,828 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,076,114 probably null Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,941,036 probably benign Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,941,048 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,149,541 probably null Het
Rsf1 CG CGATG 7: 97,579,908 probably benign Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Tcof1 CT CTAGT 18: 60,828,408 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,736 probably benign Het
Tfeb GCA GCACCA 17: 47,786,103 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,016,429 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,089,124 probably benign Het
Other mutations in Rnf144a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Rnf144a APN 12 26327301 missense probably benign 0.01
IGL02709:Rnf144a APN 12 26321010 missense probably damaging 1.00
R0432:Rnf144a UTSW 12 26339329 missense probably damaging 1.00
R3897:Rnf144a UTSW 12 26310713 missense probably damaging 1.00
R4087:Rnf144a UTSW 12 26327592 missense probably damaging 1.00
R4504:Rnf144a UTSW 12 26327303 missense probably benign 0.11
R5985:Rnf144a UTSW 12 26317780 missense probably benign 0.04
R6392:Rnf144a UTSW 12 26310780 missense possibly damaging 0.93
R7827:Rnf144a UTSW 12 26339440 start codon destroyed probably null 0.89
R8431:Rnf144a UTSW 12 26327301 missense probably damaging 1.00
RF018:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314008 critical splice donor site probably benign
RF043:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF048:Rnf144a UTSW 12 26314011 critical splice donor site probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04