Incidental Mutation 'RF036:Strn'
ID604601
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.762) question?
Stock #RF036 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTACCCCAGTC to CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCATTACCCCAGTC at 78677277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024881] [ENSMUST00000145910]
Predicted Effect probably null
Transcript: ENSMUST00000024881
SMART Domains Protein: ENSMUSP00000024881
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
low complexity region 178 195 N/A INTRINSIC
low complexity region 223 231 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
WD40 299 338 6.04e-8 SMART
WD40 352 391 2.42e-7 SMART
WD40 405 444 1.21e-7 SMART
WD40 493 539 1.28e1 SMART
WD40 542 581 4.4e-10 SMART
WD40 584 627 2.48e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145480
SMART Domains Protein: ENSMUSP00000117663
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 153 171 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145910
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,287,727 probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,905,087 probably benign Het
Adgra3 GGCCGC GGC 5: 50,058,641 probably benign Het
Blm CCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCT 7: 80,512,914 probably null Het
Calhm1 C CTGTGGCTGTGGG 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,019,870 probably benign Het
Cherp ACCTGGACC AC 8: 72,462,044 probably null Het
Cherp TGGACC T 8: 72,462,047 probably null Het
Cyb5r4 CAGACACACTGCC CAGACACACTGCCTAGGGATGTGATAGACACACTGCC 9: 87,040,430 probably benign Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,812,892 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,984,363 probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
Il2 GTGG GTGGGGCTTGAATTGG 3: 37,125,827 probably benign Het
Iqcf4 TCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTT 9: 106,570,611 probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,572,341 probably null Het
Kif12 C CCTCCACCCGGCGGGT 4: 63,171,427 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Mamld1 CAG CAGGAG X: 71,118,828 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,076,114 probably null Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,010 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,016 probably benign Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,941,036 probably benign Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,941,048 probably benign Het
Nusap1 TTAGCAGTGAGGAGCA TTAGCAGTGAGGAGCACGCTGAGATACACGCTAGCAGTGAGGAGCA 2: 119,627,587 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCAGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rnf144a TCTCTCTCTC TCTCTCTCTCTCTCTCACTCTCTCTC 12: 26,314,008 probably benign Het
Rnf144a CTCTC CTCTCTCTCTCTCTCTATCTC 12: 26,314,013 probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,149,541 probably null Het
Rsf1 CG CGATG 7: 97,579,908 probably benign Het
Setd1a GTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,300 probably benign Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Tcof1 CT CTAGT 18: 60,828,408 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,736 probably benign Het
Tfeb GCA GCACCA 17: 47,786,103 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,016,429 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,089,124 probably benign Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4431:Strn UTSW 17 78736462 missense probably damaging 1.00
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
R7716:Strn UTSW 17 78655775 missense probably damaging 0.99
R7746:Strn UTSW 17 78677372 missense probably benign 0.11
R7997:Strn UTSW 17 78684243 missense probably benign 0.01
RF006:Strn UTSW 17 78677271 frame shift probably null
RF008:Strn UTSW 17 78677287 frame shift probably null
RF017:Strn UTSW 17 78677288 frame shift probably null
RF018:Strn UTSW 17 78677283 frame shift probably null
RF031:Strn UTSW 17 78677277 frame shift probably null
RF035:Strn UTSW 17 78677285 frame shift probably null
RF038:Strn UTSW 17 78677282 frame shift probably null
RF039:Strn UTSW 17 78677278 frame shift probably null
RF044:Strn UTSW 17 78677288 frame shift probably null
RF045:Strn UTSW 17 78677282 frame shift probably null
RF047:Strn UTSW 17 78677270 frame shift probably null
RF047:Strn UTSW 17 78677274 frame shift probably null
RF048:Strn UTSW 17 78677287 frame shift probably null
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGCTTCCTTATGGCTC -3'
(R):5'- GAACACAATGTGTCTGGCTG -3'

Sequencing Primer
(F):5'- TCTCGCCCAGCCTAGACAG -3'
(R):5'- AACACAATGTGTCTGGCTGAGTTAG -3'
Posted On2019-12-04