Incidental Mutation 'RF036:Gm8369'
ID604605
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF036 (G1)
Quality Score217.468
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GTGTGT to GTGTGTATGTGT at 11511778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably benign
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTG 17: 24,287,727 probably benign Het
Acap3 G GGGCTGCATCCTGGGC 4: 155,905,087 probably benign Het
Adgra3 GGCCGC GGC 5: 50,058,641 probably benign Het
Blm CCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCT 7: 80,512,914 probably null Het
Calhm1 C CTGTGGCTGTGGG 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGTTGCTG 18: 61,019,870 probably benign Het
Cherp ACCTGGACC AC 8: 72,462,044 probably null Het
Cherp TGGACC T 8: 72,462,047 probably null Het
Cyb5r4 CAGACACACTGCC CAGACACACTGCCTAGGGATGTGATAGACACACTGCC 9: 87,040,430 probably benign Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
Fam171b GCAGC GCAGCAACAGC 2: 83,812,892 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fsip2 TTTT TTTTTCTTT 2: 82,984,363 probably benign Het
Il2 GTGG GTGGGGCTTGAATTGG 3: 37,125,827 probably benign Het
Iqcf4 TCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTT 9: 106,570,611 probably benign Het
Ivl TGCTGCTGCTGCTGC T 3: 92,572,341 probably null Het
Kif12 C CCTCCACCCGGCGGGT 4: 63,171,427 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrtm1 TAGCCTCAGTGGCC T 14: 29,021,443 probably null Het
Mamld1 CAG CAGGAG X: 71,118,828 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,835 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Morn4 GTGAG GTGAGTCAGGCAATGAG 19: 42,076,114 probably null Het
Nefh TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,010 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,016 probably benign Het
Nefh TGGCCTC TGGCCTCGCCTGGGGACTGGGCCTC 11: 4,941,036 probably benign Het
Nefh GGGAC GGGACGTGGCATCACCTGTGGAC 11: 4,941,048 probably benign Het
Nusap1 TTAGCAGTGAGGAGCA TTAGCAGTGAGGAGCACGCTGAGATACACGCTAGCAGTGAGGAGCA 2: 119,627,587 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCAGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Phc1 CTTGCTG CTTGCTGTTGCTG 6: 122,323,580 probably benign Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rnf144a TCTCTCTCTC TCTCTCTCTCTCTCTCACTCTCTCTC 12: 26,314,008 probably benign Het
Rnf144a CTCTC CTCTCTCTCTCTCTCTATCTC 12: 26,314,013 probably benign Het
Rpgrip1 AGAGGAAG A 14: 52,149,541 probably null Het
Rsf1 CG CGATG 7: 97,579,908 probably benign Het
Setd1a GTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,300 probably benign Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 CT CTAGT 18: 60,828,408 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,736 probably benign Het
Tfeb GCA GCACCA 17: 47,786,103 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAT 5: 77,016,429 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT 15: 72,801,320 probably benign Het
Ubtf CTTC CTTCTTC 11: 102,306,945 probably benign Het
Usp2 ACTTAC ACTTACTCATGTGACCCGTTCTTCCCTTAC 9: 44,089,124 probably benign Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGTGACAGTGATGG -3'
(R):5'- TTGGAGACCTCACTTCACTAAC -3'

Sequencing Primer
(F):5'- CTGTGACAGTGATGGCATCTCC -3'
(R):5'- GAGACCTCACTTCACTAACATAGGTG -3'
Posted On2019-12-04