Incidental Mutation 'RF037:Ren1'
ID604613
Institutional Source Beutler Lab
Gene Symbol Ren1
Ensembl Gene ENSMUSG00000070645
Gene Namerenin 1 structural
SynonymsRen-1, Ren1d, Ren1c, Ren, Ren-A, Rnr, Rn-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF037 (G1)
Quality Score108.467
Status Not validated
Chromosome1
Chromosomal Location133350510-133360325 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACCGC to AC at 133350781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094556] [ENSMUST00000112287]
Predicted Effect probably benign
Transcript: ENSMUST00000094556
SMART Domains Protein: ENSMUSP00000092135
Gene: ENSMUSG00000070645

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A1_Propeptide 29 54 1.2e-10 PFAM
Pfam:Asp 83 401 1.3e-120 PFAM
Pfam:TAXi_C 261 400 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112287
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to postnatal lethality, reduced plasma renin level, decreased mean arterial pressure, and kidney defects such as atrophy, altered juxtaglomerular cell and macula densa morphology, polyuria, decreased urine osmolality, and reduced glomerular filtration rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,888 probably benign Het
Abcf1 TGTC T 17: 35,963,188 probably benign Het
Ankrd24 GAGG GAGGCAGAGGCTTAGG 10: 81,643,573 probably null Het
Ckap2l TGCA T 2: 129,270,649 probably benign Het
Cox7a2l GGA GGAGGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Dnmt1 GGGGCGGAGCACAGTTCCTA GGGGCGGAGCACAGTTCCTATCTCGTATTGTGGGCGGAGCACAGTTCCTA 9: 20,910,119 probably benign Het
Dnmt1 TTCCTACCTCGTT TTCCTACCTCGTTTTGGGGGCGGAGCATAGGTCCTACCTCGTT 9: 20,910,133 probably null Het
Dnmt1 TCGTT TCGTTTTGGGGGCTGAGCACAGTTCCTACCGCGTT 9: 20,910,141 probably null Het
Ehbp1 ACTG A 11: 22,006,783 probably benign Het
Eml6 TCCTAAAAAAACAAAAC TC 11: 29,752,549 probably benign Het
Fbrsl1 G GCGTGTGCTAGTA 5: 110,378,151 probably null Het
Gabre CTC CTCCGGGTC X: 72,270,061 probably benign Het
Gm8369 GTG GTGGGTATG 19: 11,511,782 probably benign Het
Igf1r GGAGATGGAGC GGAGATGGAGCTTGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 ACAG ACAGCCCCAG 1: 83,042,145 probably benign Het
Krtap28-10 ACAGC ACAGCCACAGCCACCCCAGC 1: 83,042,286 probably benign Het
Lce1m C CCGCTGCTGCCAT 3: 93,018,300 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Map1a AGCTCCAGCTCCAGCTCCAGCTCCA AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,294 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nefh TTGGCCTCAGCTGGGGACTTGGCCTCA TTGGCCTCAGCTGGAGACTTGGCCTCAGCTGGGGACTTGGCCTCA 11: 4,940,999 probably benign Het
Nefh TGGGGACTTGG TGGGGACTTGGACTCCCCGGGGGACTTGG 11: 4,941,046 probably benign Het
Nefh TGGC TGGCGTCACCTGGGGACTGGGC 11: 4,941,054 probably benign Het
Nusap1 AGCAGTGAGGAGCAAGCTGAGA AGCAGTGAGGAGCAAGCTGAGATACACGTTCGCAGTGAGGAGCAAGCTGAGA 2: 119,627,589 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Sbp AAGATG AAGATGCTGACAACAGAGATG 17: 23,945,384 probably benign Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGGGGGCTTG 6: 72,616,036 probably benign Het
Thegl CAAGGCCAG CAAGGCCAGCGATCCTCCCCAGTCCCGAAAGGCCAG 5: 77,016,421 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Zfhx3 CAGCAGCA CAGCAGCAATAGCAGCA 8: 108,956,098 probably null Het
Other mutations in Ren1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ren1 APN 1 133358412 missense probably benign 0.00
IGL02172:Ren1 APN 1 133359033 missense possibly damaging 0.95
IGL02686:Ren1 APN 1 133358469 missense possibly damaging 0.86
3_musketeers UTSW 1 133354808 missense probably damaging 1.00
snickers UTSW 1 133356518 missense probably damaging 1.00
R0268:Ren1 UTSW 1 133355611 missense possibly damaging 0.74
R1115:Ren1 UTSW 1 133356518 missense probably damaging 1.00
R1728:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1728:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1728:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1728:Ren1 UTSW 1 133358982 unclassified probably null
R1728:Ren1 UTSW 1 133359079 missense probably benign
R1728:Ren1 UTSW 1 133359983 missense probably benign
R1728:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1729:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1729:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1729:Ren1 UTSW 1 133359079 missense probably benign
R1729:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1730:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1730:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1730:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1730:Ren1 UTSW 1 133359079 missense probably benign
R1730:Ren1 UTSW 1 133359983 missense probably benign
R1730:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1739:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1739:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1739:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1739:Ren1 UTSW 1 133359079 missense probably benign
R1739:Ren1 UTSW 1 133359983 missense probably benign
R1739:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1762:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1762:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1762:Ren1 UTSW 1 133358982 unclassified probably null
R1762:Ren1 UTSW 1 133359079 missense probably benign
R1762:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1783:Ren1 UTSW 1 133350778 unclassified probably null
R1783:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1783:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1783:Ren1 UTSW 1 133359079 missense probably benign
R1783:Ren1 UTSW 1 133359983 missense probably benign
R1783:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1784:Ren1 UTSW 1 133350778 unclassified probably null
R1784:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1784:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1784:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1784:Ren1 UTSW 1 133359079 missense probably benign
R1784:Ren1 UTSW 1 133359983 missense probably benign
R1784:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1785:Ren1 UTSW 1 133350778 unclassified probably null
R1785:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1785:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1785:Ren1 UTSW 1 133359079 missense probably benign
R1785:Ren1 UTSW 1 133359983 missense probably benign
R1785:Ren1 UTSW 1 133360007 missense probably benign 0.02
R2049:Ren1 UTSW 1 133350778 unclassified probably null
R2130:Ren1 UTSW 1 133350778 unclassified probably null
R2131:Ren1 UTSW 1 133350778 unclassified probably null
R2133:Ren1 UTSW 1 133358982 unclassified probably null
R2141:Ren1 UTSW 1 133350778 unclassified probably null
R2142:Ren1 UTSW 1 133350778 unclassified probably null
R2518:Ren1 UTSW 1 133360124 missense probably damaging 1.00
R4361:Ren1 UTSW 1 133359041 missense probably benign
R4584:Ren1 UTSW 1 133354808 missense probably damaging 1.00
R5188:Ren1 UTSW 1 133350613 unclassified probably benign
R5806:Ren1 UTSW 1 133355511 nonsense probably null
R7999:Ren1 UTSW 1 133354866 missense probably damaging 1.00
R8093:Ren1 UTSW 1 133360074 missense probably damaging 1.00
R8175:Ren1 UTSW 1 133354269 missense possibly damaging 0.94
R8259:Ren1 UTSW 1 133350796 nonsense probably null
RF044:Ren1 UTSW 1 133350781 unclassified probably benign
Z1177:Ren1 UTSW 1 133350750 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCAGAGCTGCCCTGCCA -3'
(R):5'- TAGGGCTTTCGGCTAGTCC -3'

Sequencing Primer
(F):5'- AAACAGGCTGCCTTTCATGG -3'
(R):5'- CTAGTCCCTAGGATTGTCAGAGCAG -3'
Posted On2019-12-04