Incidental Mutation 'RF037:Thegl'
ID604622
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #RF037 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) CAAGGCCAG to CAAGGCCAGCGATCCTCCCCAGTCCCGAAAGGCCAG at 77016421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,888 probably benign Het
Abcf1 TGTC T 17: 35,963,188 probably benign Het
Ankrd24 GAGG GAGGCAGAGGCTTAGG 10: 81,643,573 probably null Het
Ckap2l TGCA T 2: 129,270,649 probably benign Het
Cox7a2l GGA GGAGGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Dnmt1 GGGGCGGAGCACAGTTCCTA GGGGCGGAGCACAGTTCCTATCTCGTATTGTGGGCGGAGCACAGTTCCTA 9: 20,910,119 probably benign Het
Dnmt1 TTCCTACCTCGTT TTCCTACCTCGTTTTGGGGGCGGAGCATAGGTCCTACCTCGTT 9: 20,910,133 probably null Het
Dnmt1 TCGTT TCGTTTTGGGGGCTGAGCACAGTTCCTACCGCGTT 9: 20,910,141 probably null Het
Ehbp1 ACTG A 11: 22,006,783 probably benign Het
Eml6 TCCTAAAAAAACAAAAC TC 11: 29,752,549 probably benign Het
Fbrsl1 G GCGTGTGCTAGTA 5: 110,378,151 probably null Het
Gabre CTC CTCCGGGTC X: 72,270,061 probably benign Het
Gm8369 GTG GTGGGTATG 19: 11,511,782 probably benign Het
Igf1r GGAGATGGAGC GGAGATGGAGCTTGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 ACAG ACAGCCCCAG 1: 83,042,145 probably benign Het
Krtap28-10 ACAGC ACAGCCACAGCCACCCCAGC 1: 83,042,286 probably benign Het
Lce1m C CCGCTGCTGCCAT 3: 93,018,300 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Map1a AGCTCCAGCTCCAGCTCCAGCTCCA AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,294 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nefh TTGGCCTCAGCTGGGGACTTGGCCTCA TTGGCCTCAGCTGGAGACTTGGCCTCAGCTGGGGACTTGGCCTCA 11: 4,940,999 probably benign Het
Nefh TGGGGACTTGG TGGGGACTTGGACTCCCCGGGGGACTTGG 11: 4,941,046 probably benign Het
Nefh TGGC TGGCGTCACCTGGGGACTGGGC 11: 4,941,054 probably benign Het
Nusap1 AGCAGTGAGGAGCAAGCTGAGA AGCAGTGAGGAGCAAGCTGAGATACACGTTCGCAGTGAGGAGCAAGCTGAGA 2: 119,627,589 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Ren1 ACCGC AC 1: 133,350,781 probably benign Het
Sbp AAGATG AAGATGCTGACAACAGAGATG 17: 23,945,384 probably benign Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGGGGGCTTG 6: 72,616,036 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Zfhx3 CAGCAGCA CAGCAGCAATAGCAGCA 8: 108,956,098 probably null Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGTTCATCCGTGCGATC -3'
(R):5'- GGGAGGTCATAATCACTGCG -3'

Sequencing Primer
(F):5'- TTCATCCGTGCGATCCGAGG -3'
(R):5'- GTCATAATCACTGCGTTGGGAAAC -3'
Posted On2019-12-04