Incidental Mutation 'RF037:5430401F13Rik'
ID604626
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene NameRIKEN cDNA 5430401F13 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #RF037 (G1)
Quality Score172.468
Status Not validated
Chromosome6
Chromosomal Location131486400-131553763 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) AGGAAAAGGTGGCCAG to AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG at 131552888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
Predicted Effect probably benign
Transcript: ENSMUST00000075020
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161385
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 TGTC T 17: 35,963,188 probably benign Het
Ankrd24 GAGG GAGGCAGAGGCTTAGG 10: 81,643,573 probably null Het
Ckap2l TGCA T 2: 129,270,649 probably benign Het
Cox7a2l GGA GGAGGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Dnmt1 GGGGCGGAGCACAGTTCCTA GGGGCGGAGCACAGTTCCTATCTCGTATTGTGGGCGGAGCACAGTTCCTA 9: 20,910,119 probably benign Het
Dnmt1 TTCCTACCTCGTT TTCCTACCTCGTTTTGGGGGCGGAGCATAGGTCCTACCTCGTT 9: 20,910,133 probably null Het
Dnmt1 TCGTT TCGTTTTGGGGGCTGAGCACAGTTCCTACCGCGTT 9: 20,910,141 probably null Het
Ehbp1 ACTG A 11: 22,006,783 probably benign Het
Eml6 TCCTAAAAAAACAAAAC TC 11: 29,752,549 probably benign Het
Fbrsl1 G GCGTGTGCTAGTA 5: 110,378,151 probably null Het
Gabre CTC CTCCGGGTC X: 72,270,061 probably benign Het
Gm8369 GTG GTGGGTATG 19: 11,511,782 probably benign Het
Igf1r GGAGATGGAGC GGAGATGGAGCTTGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 ACAG ACAGCCCCAG 1: 83,042,145 probably benign Het
Krtap28-10 ACAGC ACAGCCACAGCCACCCCAGC 1: 83,042,286 probably benign Het
Lce1m C CCGCTGCTGCCAT 3: 93,018,300 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Map1a AGCTCCAGCTCCAGCTCCAGCTCCA AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,294 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nefh TTGGCCTCAGCTGGGGACTTGGCCTCA TTGGCCTCAGCTGGAGACTTGGCCTCAGCTGGGGACTTGGCCTCA 11: 4,940,999 probably benign Het
Nefh TGGGGACTTGG TGGGGACTTGGACTCCCCGGGGGACTTGG 11: 4,941,046 probably benign Het
Nefh TGGC TGGCGTCACCTGGGGACTGGGC 11: 4,941,054 probably benign Het
Nusap1 AGCAGTGAGGAGCAAGCTGAGA AGCAGTGAGGAGCAAGCTGAGATACACGTTCGCAGTGAGGAGCAAGCTGAGA 2: 119,627,589 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Ren1 ACCGC AC 1: 133,350,781 probably benign Het
Sbp AAGATG AAGATGCTGACAACAGAGATG 17: 23,945,384 probably benign Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGGGGGCTTG 6: 72,616,036 probably benign Het
Thegl CAAGGCCAG CAAGGCCAGCGATCCTCCCCAGTCCCGAAAGGCCAG 5: 77,016,421 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Zfhx3 CAGCAGCA CAGCAGCAATAGCAGCA 8: 108,956,098 probably null Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131552592 missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131552779 missense unknown
R1674:5430401F13Rik UTSW 6 131552803 missense unknown
R6374:5430401F13Rik UTSW 6 131552929 missense unknown
R6671:5430401F13Rik UTSW 6 131551350 critical splice donor site probably null
R7150:5430401F13Rik UTSW 6 131552667 missense probably benign 0.16
RF005:5430401F13Rik UTSW 6 131552884 small insertion probably benign
RF014:5430401F13Rik UTSW 6 131552857 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552856 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552859 small insertion probably benign
RF015:5430401F13Rik UTSW 6 131552861 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552855 small insertion probably benign
RF023:5430401F13Rik UTSW 6 131552878 small insertion probably benign
RF029:5430401F13Rik UTSW 6 131552895 small insertion probably benign
RF037:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552873 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552892 small insertion probably benign
RF041:5430401F13Rik UTSW 6 131552894 small insertion probably benign
RF042:5430401F13Rik UTSW 6 131552886 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552887 small insertion probably benign
RF058:5430401F13Rik UTSW 6 131552901 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552883 small insertion probably benign
RF063:5430401F13Rik UTSW 6 131552884 small insertion probably benign
X0062:5430401F13Rik UTSW 6 131552638 missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131552721 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGAAGTCCAGGATCACCAG -3'
(R):5'- ACACTTGCTGCTGTGAGAAG -3'

Sequencing Primer
(F):5'- TCCAGGATCACCAGAGTGG -3'
(R):5'- TTAAATGCTAGGTGGTGAGAATGGC -3'
Posted On2019-12-04