Incidental Mutation 'RF037:Gm8369'
ID604645
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF037 (G1)
Quality Score151.467
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GTG to GTGGGTATG at 11511782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably benign
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik AGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,888 probably benign Het
Abcf1 TGTC T 17: 35,963,188 probably benign Het
Ankrd24 GAGG GAGGCAGAGGCTTAGG 10: 81,643,573 probably null Het
Ckap2l TGCA T 2: 129,270,649 probably benign Het
Cox7a2l GGA GGAGGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Dnmt1 GGGGCGGAGCACAGTTCCTA GGGGCGGAGCACAGTTCCTATCTCGTATTGTGGGCGGAGCACAGTTCCTA 9: 20,910,119 probably benign Het
Dnmt1 TTCCTACCTCGTT TTCCTACCTCGTTTTGGGGGCGGAGCATAGGTCCTACCTCGTT 9: 20,910,133 probably null Het
Dnmt1 TCGTT TCGTTTTGGGGGCTGAGCACAGTTCCTACCGCGTT 9: 20,910,141 probably null Het
Ehbp1 ACTG A 11: 22,006,783 probably benign Het
Eml6 TCCTAAAAAAACAAAAC TC 11: 29,752,549 probably benign Het
Fbrsl1 G GCGTGTGCTAGTA 5: 110,378,151 probably null Het
Gabre CTC CTCCGGGTC X: 72,270,061 probably benign Het
Igf1r GGAGATGGAGC GGAGATGGAGCTTGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 ACAG ACAGCCCCAG 1: 83,042,145 probably benign Het
Krtap28-10 ACAGC ACAGCCACAGCCACCCCAGC 1: 83,042,286 probably benign Het
Lce1m C CCGCTGCTGCCAT 3: 93,018,300 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Map1a AGCTCCAGCTCCAGCTCCAGCTCCA AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCGGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,294 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l GCAACA GCAACAACA 3: 59,275,956 probably benign Het
Nefh TTGGCCTCAGCTGGGGACTTGGCCTCA TTGGCCTCAGCTGGAGACTTGGCCTCAGCTGGGGACTTGGCCTCA 11: 4,940,999 probably benign Het
Nefh TGGGGACTTGG TGGGGACTTGGACTCCCCGGGGGACTTGG 11: 4,941,046 probably benign Het
Nefh TGGC TGGCGTCACCTGGGGACTGGGC 11: 4,941,054 probably benign Het
Nusap1 AGCAGTGAGGAGCAAGCTGAGA AGCAGTGAGGAGCAAGCTGAGATACACGTTCGCAGTGAGGAGCAAGCTGAGA 2: 119,627,589 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Ren1 ACCGC AC 1: 133,350,781 probably benign Het
Sbp AAGATG AAGATGCTGACAACAGAGATG 17: 23,945,384 probably benign Het
Sbp ATG ATGCTGACAACAAAGCTG 17: 23,945,387 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGGGGGCTTG 6: 72,616,036 probably benign Het
Thegl CAAGGCCAG CAAGGCCAGCGATCCTCCCCAGTCCCGAAAGGCCAG 5: 77,016,421 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Zfhx3 CAGCAGCA CAGCAGCAATAGCAGCA 8: 108,956,098 probably null Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGTGACAGTGATG -3'
(R):5'- TTGGAGACCTCACTTCACTAAC -3'

Sequencing Primer
(F):5'- CTGTGACAGTGATGGCATCTCC -3'
(R):5'- GAGACCTCACTTCACTAACATAGGTG -3'
Posted On2019-12-04