Incidental Mutation 'RF038:Krtap28-10'
ID 604649
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Name keratin associated protein 28-10
Synonyms 4733401N17Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF038 (G1)
Quality Score 180.47
Status Not validated
Chromosome 1
Chromosomal Location 83041524-83042480 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) CAGCCACAGCCACCACAGCCACAGCCACCA to CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA at 83042257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
AlphaFold A0A1Y7VP58
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCATC 2: 130,770,744 probably null Het
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 87,040,442 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,767,194 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,762,164 probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,569 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,018 probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,019 probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,027 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,941,040 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,608,930 probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 156,096,106 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,677,282 probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,833,566 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83042123 unclassified probably benign
R8865:Krtap28-10 UTSW 1 83042087 missense unknown
R8984:Krtap28-10 UTSW 1 83042173 missense unknown
RF001:Krtap28-10 UTSW 1 83042255 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042280 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042279 unclassified probably benign
RF012:Krtap28-10 UTSW 1 83042136 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042274 unclassified probably benign
RF014:Krtap28-10 UTSW 1 83042251 unclassified probably benign
RF016:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042266 unclassified probably benign
RF018:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF019:Krtap28-10 UTSW 1 83042269 unclassified probably benign
RF023:Krtap28-10 UTSW 1 83042146 nonsense probably null
RF023:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042252 unclassified probably benign
RF025:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF026:Krtap28-10 UTSW 1 83042126 unclassified probably benign
RF027:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF028:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF029:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF032:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF034:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042146 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042145 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF042:Krtap28-10 UTSW 1 83042125 unclassified probably benign
RF044:Krtap28-10 UTSW 1 83042131 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042143 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042261 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF053:Krtap28-10 UTSW 1 83042278 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042130 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF058:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042275 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042290 unclassified probably benign
RF061:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF064:Krtap28-10 UTSW 1 83042131 unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83042159 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGCAGCAGCACTTCTTG -3'
(R):5'- CTCCTTGAAGCAAAGGCCATC -3'

Sequencing Primer
(F):5'- ACTTCTTGCAGCCACACTTCTG -3'
(R):5'- TGAATCCTCTCTACTGACAACATGGG -3'
Posted On 2019-12-04