Incidental Mutation 'RF038:4930402H24Rik'
ID 604653
Institutional Source Beutler Lab
Gene Symbol 4930402H24Rik
Ensembl Gene ENSMUSG00000027309
Gene Name RIKEN cDNA 4930402H24 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF038 (G1)
Quality Score 177.468
Status Not validated
Chromosome 2
Chromosomal Location 130706200-130906406 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) CTC to CTCATC at 130770744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000044766] [ENSMUST00000119422]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000044766
SMART Domains Protein: ENSMUSP00000046992
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 463 473 N/A INTRINSIC
low complexity region 533 545 N/A INTRINSIC
coiled coil region 1143 1171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119422
SMART Domains Protein: ENSMUSP00000113481
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 332 342 N/A INTRINSIC
low complexity region 402 414 N/A INTRINSIC
coiled coil region 1012 1040 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145851
SMART Domains Protein: ENSMUSP00000118946
Gene: ENSMUSG00000027309

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 87,040,442 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,767,194 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,762,164 probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,569 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,042,128 probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,042,257 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,018 probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,019 probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,027 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,941,040 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,608,930 probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 156,096,106 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,677,282 probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,833,566 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in 4930402H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:4930402H24Rik APN 2 130784457 missense probably benign 0.00
IGL01093:4930402H24Rik APN 2 130777236 missense probably benign 0.01
IGL01111:4930402H24Rik APN 2 130736598 missense possibly damaging 0.66
IGL01146:4930402H24Rik APN 2 130770671 critical splice donor site probably null
IGL01346:4930402H24Rik APN 2 130791846 splice site probably benign
IGL01548:4930402H24Rik APN 2 130814259 missense probably damaging 1.00
IGL02339:4930402H24Rik APN 2 130739465 missense probably damaging 0.97
IGL02637:4930402H24Rik APN 2 130814307 intron probably benign
IGL02926:4930402H24Rik APN 2 130712366 missense probably benign 0.00
IGL02978:4930402H24Rik APN 2 130727162 missense probably damaging 0.99
IGL03126:4930402H24Rik APN 2 130791995 splice site probably null
IGL03387:4930402H24Rik APN 2 130717280 missense probably damaging 1.00
best_times UTSW 2 130736576 missense probably damaging 0.99
Hard_times UTSW 2 130713470 missense probably benign 0.16
worst_times UTSW 2 130713414 missense probably damaging 1.00
FR4304:4930402H24Rik UTSW 2 130770748 small insertion probably benign
FR4342:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770745 small insertion probably benign
FR4589:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4737:4930402H24Rik UTSW 2 130770752 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770739 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770742 small insertion probably benign
FR4976:4930402H24Rik UTSW 2 130770753 small insertion probably benign
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0034:4930402H24Rik UTSW 2 130736572 missense probably damaging 1.00
R0357:4930402H24Rik UTSW 2 130712946 splice site probably benign
R0379:4930402H24Rik UTSW 2 130785546 splice site probably benign
R0515:4930402H24Rik UTSW 2 130740488 missense probably damaging 1.00
R0576:4930402H24Rik UTSW 2 130713470 missense probably benign 0.16
R0811:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R0812:4930402H24Rik UTSW 2 130713414 missense probably damaging 1.00
R1334:4930402H24Rik UTSW 2 130775722 splice site probably null
R1485:4930402H24Rik UTSW 2 130748683 critical splice donor site probably null
R1486:4930402H24Rik UTSW 2 130737418 missense probably damaging 1.00
R1670:4930402H24Rik UTSW 2 130712379 missense probably damaging 1.00
R1678:4930402H24Rik UTSW 2 130814273 missense probably damaging 0.99
R1700:4930402H24Rik UTSW 2 130709938 missense probably damaging 0.99
R1742:4930402H24Rik UTSW 2 130740395 splice site probably null
R2046:4930402H24Rik UTSW 2 130810917 missense possibly damaging 0.61
R2374:4930402H24Rik UTSW 2 130820574 missense probably damaging 1.00
R3878:4930402H24Rik UTSW 2 130778503 missense possibly damaging 0.92
R3907:4930402H24Rik UTSW 2 130736576 missense probably damaging 0.99
R4467:4930402H24Rik UTSW 2 130767647 missense probably damaging 0.96
R4931:4930402H24Rik UTSW 2 130741873 missense possibly damaging 0.58
R5098:4930402H24Rik UTSW 2 130798181 missense probably damaging 0.99
R5191:4930402H24Rik UTSW 2 130737403 missense possibly damaging 0.68
R5313:4930402H24Rik UTSW 2 130709268 missense probably damaging 1.00
R5405:4930402H24Rik UTSW 2 130712460 missense probably damaging 1.00
R5436:4930402H24Rik UTSW 2 130764499 missense probably benign 0.16
R5522:4930402H24Rik UTSW 2 130814302 intron probably benign
R5783:4930402H24Rik UTSW 2 130739083 missense possibly damaging 0.59
R5931:4930402H24Rik UTSW 2 130814189 missense probably damaging 1.00
R6145:4930402H24Rik UTSW 2 130778473 missense probably benign
R6732:4930402H24Rik UTSW 2 130810820 critical splice donor site probably null
R6938:4930402H24Rik UTSW 2 130775753 missense probably benign 0.00
R7161:4930402H24Rik UTSW 2 130806788 missense unknown
R7193:4930402H24Rik UTSW 2 130806788 missense unknown
R7194:4930402H24Rik UTSW 2 130806788 missense unknown
R7233:4930402H24Rik UTSW 2 130806788 missense unknown
R7234:4930402H24Rik UTSW 2 130806788 missense unknown
R7238:4930402H24Rik UTSW 2 130806788 missense unknown
R7239:4930402H24Rik UTSW 2 130806788 missense unknown
R7268:4930402H24Rik UTSW 2 130806788 missense unknown
R7807:4930402H24Rik UTSW 2 130710865 missense probably damaging 1.00
R7904:4930402H24Rik UTSW 2 130792003 splice site probably null
R7999:4930402H24Rik UTSW 2 130737452 missense probably benign 0.00
R8047:4930402H24Rik UTSW 2 130775099 missense probably damaging 0.98
R8286:4930402H24Rik UTSW 2 130717328 missense probably damaging 1.00
R8315:4930402H24Rik UTSW 2 130770735 small deletion probably benign
R8439:4930402H24Rik UTSW 2 130770701 missense probably damaging 1.00
R8925:4930402H24Rik UTSW 2 130737380 nonsense probably null
R8927:4930402H24Rik UTSW 2 130737380 nonsense probably null
R9070:4930402H24Rik UTSW 2 130812873 missense possibly damaging 0.61
R9367:4930402H24Rik UTSW 2 130739460 missense probably benign 0.00
RF027:4930402H24Rik UTSW 2 130770744 small insertion probably benign
RF046:4930402H24Rik UTSW 2 130770734 nonsense probably null
RF048:4930402H24Rik UTSW 2 130770734 nonsense probably null
Z1177:4930402H24Rik UTSW 2 130710867 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AATCAGTTGGCTGGCTGTCATC -3'
(R):5'- TCAGGGATCCATCACCTGTTGG -3'

Sequencing Primer
(F):5'- CTGGCTGTCATCTTTGGCTTAG -3'
(R):5'- CCATCACCTGTTGGAAAGTCTGAG -3'
Posted On 2019-12-04