Incidental Mutation 'RF038:Il2'
ID 604655
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF038 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) CTT to CTTCAAGTGGGGATT at 37179970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably null
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,891,301 (GRCm39) probably benign Het
Abcf1 CTCTTC CTC 17: 36,274,093 (GRCm39) probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,989,549 (GRCm39) probably benign Het
AI837181 GGC GGCAGC 19: 5,475,254 (GRCm39) probably benign Het
AI837181 GCG GCGACG 19: 5,475,264 (GRCm39) probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 86,922,495 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,465,750 (GRCm39) probably benign Het
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,466,619 (GRCm39) probably benign Het
Dnaaf9 CTC CTCATC 2: 130,612,664 (GRCm39) probably null Het
Enah TGGCGGCGG TGG 1: 181,749,500 (GRCm39) probably benign Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,981,138 (GRCm39) probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,519,343 (GRCm39) probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,824,352 (GRCm39) probably null Het
Garin5a TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,149,946 (GRCm39) probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,324,342 (GRCm39) probably benign Het
Gas1 AG AGATG 13: 60,324,344 (GRCm39) probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 155,128,636 (GRCm39) probably null Het
Habp4 TGAGG TG 13: 64,309,976 (GRCm39) probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 (GRCm39) probably benign Het
Irag2 TG TGAGCACATCG 6: 145,119,516 (GRCm39) probably benign Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,607 (GRCm39) probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,019,849 (GRCm39) probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,019,978 (GRCm39) probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,530,521 (GRCm39) probably null Het
Mamld1 CAG CAGGAG X: 70,162,452 (GRCm39) probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,027 (GRCm39) probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,029 (GRCm39) probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,891,040 (GRCm39) probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,012 (GRCm39) probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,018 (GRCm39) probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,019 (GRCm39) probably benign Het
Pabpc6 AGCTGC AGC 17: 9,887,044 (GRCm39) probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,421,899 (GRCm39) probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,756,783 (GRCm39) probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,756,789 (GRCm39) probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 155,938,026 (GRCm39) probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 24,164,358 (GRCm39) probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,984,711 (GRCm39) probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,966,638 (GRCm39) probably benign Het
Tfeb AGC AGCGGC 17: 48,097,030 (GRCm39) probably benign Het
Tfeb GCA GCACCA 17: 48,097,037 (GRCm39) probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,673,172 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 109,682,733 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCATCCTGGGGAGTTTCAG -3'
(R):5'- GCATTAACAGTATAAATTGCCTCCC -3'

Sequencing Primer
(F):5'- CAGGTTCCTGTAATTCTGAGAAAGCG -3'
(R):5'- ATTGCCTCCCATGCTGAAGAG -3'
Posted On 2019-12-04