Incidental Mutation 'RF038:Foxd3'
ID 604659
Institutional Source Beutler Lab
Gene Symbol Foxd3
Ensembl Gene ENSMUSG00000067261
Gene Name forkhead box D3
Synonyms CWH3, Genesis, Hfh2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF038 (G1)
Quality Score 217.468
Status Not validated
Chromosome 4
Chromosomal Location 99656299-99658622 bp(+) (GRCm38)
Type of Mutation small deletion (4 aa in frame mutation)
DNA Base Change (assembly) GGACCCTACGGCCG to GG at 99657396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087285]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087285
SMART Domains Protein: ENSMUSP00000084541
Gene: ENSMUSG00000067261

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 99 121 N/A INTRINSIC
FH 129 219 1.01e-60 SMART
low complexity region 247 312 N/A INTRINSIC
low complexity region 323 334 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
low complexity region 373 404 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175022
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. Mutations in this gene cause autoimmune susceptibility 1. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for null alleles dsiplay embryonic lethality with failure of primitive streak formation and gastrulation and failure to derive cultures of embryonic or trophoblast stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCATC 2: 130,770,744 probably null Het
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 87,040,442 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,767,194 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,762,164 probably null Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,569 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,042,128 probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,042,257 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,018 probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,019 probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,027 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,941,040 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,608,930 probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 156,096,106 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,677,282 probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,833,566 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in Foxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02483:Foxd3 APN 4 99657028 missense probably damaging 1.00
IGL02936:Foxd3 APN 4 99656815 missense probably benign 0.41
IGL03392:Foxd3 APN 4 99657195 missense probably damaging 0.99
FR4304:Foxd3 UTSW 4 99657396 small deletion probably benign
R3899:Foxd3 UTSW 4 99657499 missense unknown
R5034:Foxd3 UTSW 4 99657090 missense probably damaging 0.98
R6226:Foxd3 UTSW 4 99657024 missense probably damaging 1.00
R6244:Foxd3 UTSW 4 99657240 missense possibly damaging 0.48
R6272:Foxd3 UTSW 4 99656740 missense probably damaging 1.00
R7152:Foxd3 UTSW 4 99657325 missense probably benign 0.02
R7676:Foxd3 UTSW 4 99656914 missense probably damaging 0.98
R7762:Foxd3 UTSW 4 99657125 nonsense probably null
R7908:Foxd3 UTSW 4 99657339 missense probably benign 0.14
R7993:Foxd3 UTSW 4 99656604 start gained probably benign
RF026:Foxd3 UTSW 4 99657396 small deletion probably benign
RF036:Foxd3 UTSW 4 99657396 small deletion probably benign
Z1176:Foxd3 UTSW 4 99657066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTTCGTCAAGATCCCC -3'
(R):5'- TTCTCGATGCTGAACGACG -3'

Sequencing Primer
(F):5'- TCAAGATCCCCCGCGAG -3'
(R):5'- TCGGACTTGATGAGCGACG -3'
Posted On 2019-12-04