Incidental Mutation 'RF038:Acap3'
ID 604660
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Synonyms Centb5, Kiaa1716-hp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # RF038 (G1)
Quality Score 217.68
Status Not validated
Chromosome 4
Chromosomal Location 155891822-155907251 bp(+) (GRCm38)
Type of Mutation small insertion (5 aa in frame mutation)
DNA Base Change (assembly) GCATCCTGGGCTGCT to GCATCCTGGGCTGCTTCATCCTGGGCTGCT at 155905092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
AlphaFold Q6NXL5
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCATC 2: 130,770,744 probably null Het
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 87,040,442 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,767,194 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,762,164 probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,569 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,042,128 probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,042,257 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,018 probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,019 probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,027 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,941,040 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,608,930 probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 156,096,106 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,677,282 probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,833,566 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5482:Acap3 UTSW 4 155900156 missense probably benign 0.00
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5769:Acap3 UTSW 4 155902400 missense probably damaging 0.99
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
R8722:Acap3 UTSW 4 155905958 makesense probably null
R8810:Acap3 UTSW 4 155905712 missense probably damaging 1.00
R8902:Acap3 UTSW 4 155905914 missense possibly damaging 0.67
R9182:Acap3 UTSW 4 155905435 missense probably damaging 1.00
R9255:Acap3 UTSW 4 155905688 missense probably benign 0.07
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF010:Acap3 UTSW 4 155905096 small insertion probably benign
RF013:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF034:Acap3 UTSW 4 155905092 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGTTCTTGCCTTCGG -3'
(R):5'- GCACACGTAGGTATGCAGTC -3'

Sequencing Primer
(F):5'- AGTGGTGGACAGTGTCACC -3'
(R):5'- GCAGTCTTGTTTTTCATATAAGCCC -3'
Posted On 2019-12-04