Incidental Mutation 'RF038:Rassf6'
ID 604662
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # RF038 (G1)
Quality Score 192.468
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) GCAATGGGGATTC to GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC at 90756789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,891,301 (GRCm39) probably benign Het
Abcf1 CTCTTC CTC 17: 36,274,093 (GRCm39) probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,989,549 (GRCm39) probably benign Het
AI837181 GGC GGCAGC 19: 5,475,254 (GRCm39) probably benign Het
AI837181 GCG GCGACG 19: 5,475,264 (GRCm39) probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 86,922,495 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,465,750 (GRCm39) probably benign Het
Dennd10 ACTC ACTCCTC 19: 60,803,056 (GRCm39) probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,466,619 (GRCm39) probably benign Het
Dnaaf9 CTC CTCATC 2: 130,612,664 (GRCm39) probably null Het
Enah TGGCGGCGG TGG 1: 181,749,500 (GRCm39) probably benign Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,981,138 (GRCm39) probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,519,343 (GRCm39) probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,824,352 (GRCm39) probably null Het
Garin5a TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,149,946 (GRCm39) probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,324,342 (GRCm39) probably benign Het
Gas1 AG AGATG 13: 60,324,344 (GRCm39) probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 155,128,636 (GRCm39) probably null Het
Habp4 TGAGG TG 13: 64,309,976 (GRCm39) probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 (GRCm39) probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,179,970 (GRCm39) probably null Het
Irag2 TG TGAGCACATCG 6: 145,119,516 (GRCm39) probably benign Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,479,607 (GRCm39) probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,019,849 (GRCm39) probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,019,978 (GRCm39) probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,530,521 (GRCm39) probably null Het
Mamld1 CAG CAGGAG X: 70,162,452 (GRCm39) probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,027 (GRCm39) probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,029 (GRCm39) probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,891,040 (GRCm39) probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,012 (GRCm39) probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,018 (GRCm39) probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,019 (GRCm39) probably benign Het
Pabpc6 AGCTGC AGC 17: 9,887,044 (GRCm39) probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,421,899 (GRCm39) probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 155,938,026 (GRCm39) probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 24,164,358 (GRCm39) probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,984,711 (GRCm39) probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,966,638 (GRCm39) probably benign Het
Tfeb AGC AGCGGC 17: 48,097,030 (GRCm39) probably benign Het
Tfeb GCA GCACCA 17: 48,097,037 (GRCm39) probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,673,172 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 109,682,733 (GRCm39) probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTAGGCATCTGCTACCG -3'
(R):5'- AGCCAGGAAATAGCAGTCATTC -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On 2019-12-04