Incidental Mutation 'RF038:Rassf6'
ID 604662
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # RF038 (G1)
Quality Score 192.468
Status Not validated
Chromosome 5
Chromosomal Location 90603076-90640657 bp(-) (GRCm38)
Type of Mutation utr 3 prime
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCATC 2: 130,770,744 probably null Het
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACACACACACTGCGCAGGGA 9: 87,040,442 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Krtap28-10 CA CAACCAAA 1: 83,042,128 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90631532 missense possibly damaging 0.83
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF004:Rassf6 UTSW 5 90608919 utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04