Incidental Mutation 'RF038:Cyb5r4'
ID604667
Institutional Source Beutler Lab
Gene Symbol Cyb5r4
Ensembl Gene ENSMUSG00000032872
Gene Namecytochrome b5 reductase 4
Synonymsb5/b5r, Ncb5or, B5+B5R, 2810034J18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF038 (G1)
Quality Score217.468
Status Not validated
Chromosome9
Chromosomal Location87022014-87077774 bp(+) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) CCAGGGA to CCAGGGATGTGACACACACACTGCGCAGGGA at 87040442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168529]
Predicted Effect probably benign
Transcript: ENSMUST00000168529
SMART Domains Protein: ENSMUSP00000126119
Gene: ENSMUSG00000032872

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Cyt-b5 57 130 2.56e-26 SMART
Pfam:CS 175 253 4.1e-16 PFAM
Pfam:FAD_binding_6 284 391 4.1e-22 PFAM
Pfam:NAD_binding_1 402 508 4.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mice exhibit defects in glucose homeostasis and pancreatic abnormalities consistent with symptoms of diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik CTC CTCATC 2: 130,770,744 probably null Het
A030005L19Rik TGT TGTAGCTGCGGT 1: 82,913,580 probably benign Het
Abcf1 CTCTTC CTC 17: 35,963,201 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
AI837181 GGC GGCAGC 19: 5,425,226 probably benign Het
AI837181 GCG GCGACG 19: 5,425,236 probably benign Het
Cdx1 CTGCTG CTGCTGGTGCTG 18: 61,019,870 probably benign Het
Dbr1 GAGGAG GAGGAGAAGGAG 9: 99,583,697 probably benign Het
Dmkn GTGGAAGTGGTGG GTGGAAGTGGTGGAAGTGGTGGAAGTGTTGGAAGTGGTGG 7: 30,767,194 probably benign Het
Enah TGGCGGCGG TGG 1: 181,921,935 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fam71e1 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA 7: 44,500,522 probably null Het
Flywch1 ACCCACTCCTGGTGT ACCCACTCCTGGTGTGGGGAGGCTACGTACTCCCCCACTCCTGGTGT 17: 23,762,164 probably null Het
Foxd3 GGACCCTACGGCCG GG 4: 99,657,396 probably benign Het
Fscb CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT CTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAAATTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,569 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gas1 CGAGGA CGAGGAGGA 13: 60,176,528 probably benign Het
Gas1 AG AGATG 13: 60,176,530 probably benign Het
Gm15155 CAAAAA CAAAAACAAAAAA X: 156,345,640 probably null Het
Habp4 TGAGG TG 13: 64,162,162 probably benign Het
Hsdl2 CACAGCTGCAG CACAGCTGCAGCAGCAGCGACAGCTGCAG 4: 59,610,648 probably benign Het
Il2 CTT CTTCAAGTGGGGATT 3: 37,125,821 probably null Het
Ivl CTTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,300 probably benign Het
Krtap28-10 CA CAACCAAA 1: 83,042,128 probably benign Het
Krtap28-10 CAGCCACAGCCACCACAGCCACAGCCACCA CAGCCACAGCCACCAAAGCCACAGCCACCACAGCCACAGCCACCA 1: 83,042,257 probably benign Het
Lmx1b CATCTTGATGCCGTCCAA C 2: 33,640,509 probably null Het
Lrmp TG TGAGCACATCG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGGAG X: 71,118,846 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,018 probably benign Het
Nefh GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,019 probably benign Het
Nefh CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC CTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,027 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nefh CTCACCTGGGGACTTGGC CTCACCTGGGGACTTGGCATCACCTGGGGACTTGGC 11: 4,941,040 probably benign Het
Pabpc6 AGCTGC AGC 17: 9,668,115 probably benign Het
Pkhd1l1 TTTTTT TTTTTTTTGTTTTT 15: 44,558,503 probably benign Het
Rassf6 TGTAGAGCAATGGGGATTC TGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCAGTAGAGCAATGGGGATTC 5: 90,608,924 probably benign Het
Rassf6 GCAATGGGGATTC GCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGATCAATGGGGATTC 5: 90,608,930 probably benign Het
Rbm12 CAGGTATTGCGGGACC CAGGTATTGCGGGACCTGGTATTGCGGGACCAGGTATTGCGGGACC 2: 156,096,106 probably benign Het
Sbp AAGATG AAGATGCTGACAACACAGATG 17: 23,945,384 probably benign Het
Strn CCCAGTC CCCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACGCCAGTC 17: 78,677,282 probably null Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,727,647 probably benign Het
Tcof1 TCCCAGAGATCCCC TCCCAGAGATCCCCCTGGCTGCTGAGATGGGCACTTCCCCAGAGATCCCC 18: 60,833,566 probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTCCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCA CAGCACCAGAAGCA 8: 108,956,101 probably benign Het
Other mutations in Cyb5r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Cyb5r4 APN 9 87059452 critical splice donor site probably null
cello UTSW 9 87029538 nonsense probably null
viol UTSW 9 87059077 critical splice donor site probably null
PIT1430001:Cyb5r4 UTSW 9 87038738 missense probably benign
R0040:Cyb5r4 UTSW 9 87066742 splice site probably null
R0373:Cyb5r4 UTSW 9 87027040 missense probably damaging 0.99
R0755:Cyb5r4 UTSW 9 87029572 missense probably damaging 1.00
R1381:Cyb5r4 UTSW 9 87022233 missense probably benign 0.03
R1488:Cyb5r4 UTSW 9 87029538 nonsense probably null
R1510:Cyb5r4 UTSW 9 87066643 intron probably benign
R1856:Cyb5r4 UTSW 9 87022209 missense possibly damaging 0.61
R1857:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1858:Cyb5r4 UTSW 9 87041279 missense probably benign 0.00
R1870:Cyb5r4 UTSW 9 87040409 missense probably benign 0.00
R1876:Cyb5r4 UTSW 9 87055814 missense probably damaging 1.00
R1959:Cyb5r4 UTSW 9 87055849 missense possibly damaging 0.82
R2036:Cyb5r4 UTSW 9 87042879 splice site probably benign
R2895:Cyb5r4 UTSW 9 87040399 nonsense probably null
R4226:Cyb5r4 UTSW 9 87057229 missense probably damaging 0.99
R4655:Cyb5r4 UTSW 9 87059429 missense probably benign 0.01
R4971:Cyb5r4 UTSW 9 87057171 missense possibly damaging 0.80
R5038:Cyb5r4 UTSW 9 87059077 critical splice donor site probably null
R5155:Cyb5r4 UTSW 9 87040403 missense probably benign 0.08
R5187:Cyb5r4 UTSW 9 87026948 missense possibly damaging 0.92
R5654:Cyb5r4 UTSW 9 87047480 missense probably damaging 0.98
R5659:Cyb5r4 UTSW 9 87055828 missense probably benign 0.22
R5926:Cyb5r4 UTSW 9 87057261 missense probably benign 0.04
R6083:Cyb5r4 UTSW 9 87057168 missense probably damaging 1.00
R6610:Cyb5r4 UTSW 9 87059417 missense probably benign
R7311:Cyb5r4 UTSW 9 87055782 missense probably damaging 1.00
R7662:Cyb5r4 UTSW 9 87027038 missense possibly damaging 0.83
R7748:Cyb5r4 UTSW 9 87032381 missense probably damaging 1.00
R8171:Cyb5r4 UTSW 9 87042810 missense possibly damaging 0.81
R8253:Cyb5r4 UTSW 9 87059055 missense probably damaging 1.00
R8369:Cyb5r4 UTSW 9 87040433 missense probably benign 0.00
RF001:Cyb5r4 UTSW 9 87040416 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF006:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF013:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF014:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040432 small insertion probably benign
RF015:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040425 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040441 small insertion probably benign
RF016:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF024:Cyb5r4 UTSW 9 87040435 small insertion probably benign
RF025:Cyb5r4 UTSW 9 87040444 small insertion probably benign
RF026:Cyb5r4 UTSW 9 87040433 small insertion probably benign
RF027:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF029:Cyb5r4 UTSW 9 87040442 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF030:Cyb5r4 UTSW 9 87040415 small insertion probably benign
RF031:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF032:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040417 small insertion probably benign
RF034:Cyb5r4 UTSW 9 87040447 nonsense probably null
RF036:Cyb5r4 UTSW 9 87040430 small insertion probably benign
RF040:Cyb5r4 UTSW 9 87040409 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040411 small insertion probably benign
RF043:Cyb5r4 UTSW 9 87040431 small insertion probably benign
RF045:Cyb5r4 UTSW 9 87040402 nonsense probably null
RF045:Cyb5r4 UTSW 9 87040447 small insertion probably benign
RF052:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF053:Cyb5r4 UTSW 9 87040422 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040414 small insertion probably benign
RF055:Cyb5r4 UTSW 9 87040438 small insertion probably benign
RF056:Cyb5r4 UTSW 9 87040410 small insertion probably benign
RF059:Cyb5r4 UTSW 9 87040445 small insertion probably benign
RF060:Cyb5r4 UTSW 9 87040413 small insertion probably benign
RF061:Cyb5r4 UTSW 9 87040435 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CACTGGGAGAGAGTAAGCTTTTG -3'
(R):5'- TGCCTCTGCATCTGATAAATGAG -3'

Sequencing Primer
(F):5'- AAAATGCTGGTGACAAGGGTTTCTC -3'
(R):5'- CTGCATCTGATAAATGAGGTACTGC -3'
Posted On2019-12-04