Incidental Mutation 'RF039:Il2'
ID 604699
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF039 (G1)
Quality Score 171.468
Status Not validated
Chromosome 3
Chromosomal Location 37120523-37125959 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GG to GGGCTTGTTGTGTG at 37125842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,918 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cd276 G A 9: 58,535,504 R223C probably damaging Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dcdc2b GCTGC GCTGCCAGGTCTGC 4: 129,609,651 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml6 CTAAAAAAACAAAACA C 11: 29,752,551 probably benign Het
Eps8 C CTCAT 6: 137,517,070 probably null Het
Exd2 CACAGCCA C 12: 80,475,941 probably null Het
Gab3 TTC TTCGTC X: 75,000,004 probably benign Het
Gm10718 ATTTTCAGTTTCCTCGCCATATTCCAGGTCCTACAGTGTGCATTTCTCATTTTTCACGTTTTTCAGT ATTTTCAGT 9: 3,024,385 probably null Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,758 probably benign Het
Gm8369 GTG GTGTTTTTG 19: 11,511,782 probably benign Het
Igf1r GG GGTGATGGAGCTTG 7: 68,226,176 probably benign Het
Kif12 GGC GGCCTCCAACCGGCCAGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Lypd8 ACCAATCACCAAC ACCAATCACCAACTGTTCCCTCGCCTCTGTTTCCCCCCCAATCACCAAC 11: 58,390,231 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Map1a CCAGC CCAGCCCCAGCTCCAGCTCCAGCTCCAGCTACAGC 2: 121,306,304 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Nefh AGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC AGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,007 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAGA G 19: 47,113,455 probably null Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTTAACATC 7: 16,961,444 probably benign Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGTTCCTGTAGAGCAATGGGGTTTC 5: 90,608,939 probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCCCCATGATCACTGTGCTC 15: 76,614,870 probably benign Het
Slc39a4 TC TCATCGTGATCACCATGGTCACCATGATCACTGTGGAC 15: 76,614,871 probably benign Het
Strn TTACCCC TTACCCCTGGCCGTGCTCCCTTACCCCAGTCCGTGCGCCCGTACCCC 17: 78,677,278 probably null Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,095 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,110 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Thegl GCGATCCTCCCCAGTCCCGCAAGGCCA GCGATCCTCCCCAGGCCCGCAAGGCCACCGATCCTCCCCAGTCCCGCAAGGCCA 5: 77,016,402 probably benign Het
Tmem28 CCG CCGCCGGCG X: 99,821,372 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGG CCCCAGGACTCCCTGTGCCCAACGGAACAAACCCAGGACTCCCTGTGCCCAACGG 15: 78,967,036 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zc3h4 TGACATGCACCCTGACATGCACCCAGACATGCACCCCGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA TGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA 7: 16,429,618 probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37123007 missense possibly damaging 0.64
IGL02047:Il2 APN 3 37125851 missense probably benign 0.01
FR4304:Il2 UTSW 3 37125826 unclassified probably benign
FR4737:Il2 UTSW 3 37125764 unclassified probably benign
FR4737:Il2 UTSW 3 37125828 unclassified probably benign
FR4976:Il2 UTSW 3 37125829 unclassified probably benign
R8805:Il2 UTSW 3 37123133 missense possibly damaging 0.78
R9287:Il2 UTSW 3 37125839 missense probably damaging 0.99
RF001:Il2 UTSW 3 37125762 unclassified probably benign
RF023:Il2 UTSW 3 37125820 unclassified probably benign
RF029:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125827 unclassified probably benign
RF030:Il2 UTSW 3 37125842 unclassified probably benign
RF033:Il2 UTSW 3 37125764 unclassified probably benign
RF033:Il2 UTSW 3 37125842 unclassified probably benign
RF036:Il2 UTSW 3 37125827 unclassified probably benign
RF038:Il2 UTSW 3 37125821 nonsense probably null
RF041:Il2 UTSW 3 37125842 unclassified probably benign
RF043:Il2 UTSW 3 37125842 unclassified probably benign
RF051:Il2 UTSW 3 37125841 unclassified probably benign
RF058:Il2 UTSW 3 37125817 unclassified probably benign
RF058:Il2 UTSW 3 37125821 unclassified probably benign
RF061:Il2 UTSW 3 37125841 unclassified probably benign
RF064:Il2 UTSW 3 37125764 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTATTAAACACAGCCTTTGGC -3'
(R):5'- GCCACACAGGTAGACTCTTTG -3'

Sequencing Primer
(F):5'- TTTGGCAAGAAAGCTAAAGGTATTGC -3'
(R):5'- GTAATATGTAAAACATCGTGACACCC -3'
Posted On 2019-12-04