Incidental Mutation 'RF039:Rassf6'
ID 604708
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # RF039 (G1)
Quality Score 105.467
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) ATTC to ATTCTGCCTCACTCATGTTCCTGTAGAGCAATGGGGTTTC at 90756798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,989,549 (GRCm39) probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,971 (GRCm39) probably benign Het
Camkv CGCTGCTGC CGC 9: 107,825,059 (GRCm39) probably benign Het
Cckbr GCA G 7: 105,083,893 (GRCm39) probably null Het
Cd276 G A 9: 58,442,787 (GRCm39) R223C probably damaging Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cul9 CCT CCTTCT 17: 46,811,780 (GRCm39) probably benign Het
Dcdc2b GCTGC GCTGCCAGGTCTGC 4: 129,503,444 (GRCm39) probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Eml6 CTAAAAAAACAAAACA C 11: 29,702,551 (GRCm39) probably benign Het
Eps8 C CTCAT 6: 137,494,068 (GRCm39) probably null Het
Exd2 CACAGCCA C 12: 80,522,715 (GRCm39) probably null Het
Gab3 TTC TTCGTC X: 74,043,610 (GRCm39) probably benign Het
Gm10718 ATTTTCAGTTTCCTCGCCATATTCCAGGTCCTACAGTGTGCATTTCTCATTTTTCACGTTTTTCAGT ATTTTCAGT 9: 3,024,385 (GRCm39) probably null Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,489,122 (GRCm39) probably benign Het
Gm8369 GTG GTGTTTTTG 19: 11,489,146 (GRCm39) probably benign Het
Igf1r GG GGTGATGGAGCTTG 7: 67,875,924 (GRCm39) probably benign Het
Il2 GG GGGCTTGTTGTGTG 3: 37,179,991 (GRCm39) probably benign Het
Kif12 GGC GGCCTCCAACCGGCCAGC 4: 63,089,662 (GRCm39) probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,625,026 (GRCm39) probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 75,184,989 (GRCm39) probably benign Het
Lypd8 ACCAATCACCAAC ACCAATCACCAACTGTTCCCTCGCCTCTGTTTCCCCCCCAATCACCAAC 11: 58,281,057 (GRCm39) probably benign Het
Mamld1 AGC AGCCGC X: 70,162,432 (GRCm39) probably benign Het
Mamld1 CAG CAGAAG X: 70,162,446 (GRCm39) probably benign Het
Map1a CCAGC CCAGCCCCAGCTCCAGCTCCAGCTCCAGCTACAGC 2: 121,136,785 (GRCm39) probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,875,749 (GRCm39) probably benign Het
Nalf2 CCG CCGCCGGCG X: 98,864,978 (GRCm39) probably benign Het
Nefh AGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC AGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,007 (GRCm39) probably benign Het
Or4k41 G A 2: 111,279,896 (GRCm39) G137D not run Het
Pdcd11 GGAGGAGA G 19: 47,101,894 (GRCm39) probably null Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,712,167 (GRCm39) probably benign Het
Pnma8a CAACATC CAACATCTCATGATGCACCTGCTTTAACATC 7: 16,695,369 (GRCm39) probably benign Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,577,464 (GRCm39) probably benign Het
Prr5l GCCTC G 2: 101,627,918 (GRCm39) probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCCCCATGATCACTGTGCTC 15: 76,499,070 (GRCm39) probably benign Het
Slc39a4 TC TCATCGTGATCACCATGGTCACCATGATCACTGTGGAC 15: 76,499,071 (GRCm39) probably benign Het
Speer4a3 CTTT C 5: 26,155,857 (GRCm39) probably benign Het
Spmap2l GCGATCCTCCCCAGTCCCGCAAGGCCA GCGATCCTCCCCAGGCCCGCAAGGCCACCGATCCTCCCCAGTCCCGCAAGGCCA 5: 77,164,249 (GRCm39) probably benign Het
Strn TTACCCC TTACCCCTGGCCGTGCTCCCTTACCCCAGTCCGTGCGCCCGTACCCC 17: 78,984,707 (GRCm39) probably null Het
Tbc1d12 CGGAGGAGG CGG 19: 38,825,401 (GRCm39) probably benign Het
Tent4a GACA G 13: 69,681,973 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,020 (GRCm39) probably benign Het
Tfeb CAG CAGTAG 17: 48,097,035 (GRCm39) probably null Het
Thbs1 TGACCTTAG TG 2: 117,953,346 (GRCm39) probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,239,762 (GRCm39) probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGG CCCCAGGACTCCCTGTGCCCAACGGAACAAACCCAGGACTCCCTGTGCCCAACGG 15: 78,851,236 (GRCm39) probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,851,239 (GRCm39) probably benign Het
Ufl1 C T 4: 25,280,628 (GRCm39) R73Q possibly damaging Het
Yipf3 AGAGGA AGA 17: 46,559,898 (GRCm39) probably benign Het
Zc3h4 TGACATGCACCCTGACATGCACCCAGACATGCACCCCGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA TGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA 7: 16,163,543 (GRCm39) probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTAGGCATCTGCTACCGC -3'
(R):5'- CAGTGAACGGCTTGGAACAG -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- CAGCCAGGAAATAGCAGTCATTCTTG -3'
Posted On 2019-12-04