Incidental Mutation 'RF039:Pnmal1'
ID604713
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene NamePNMA-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #RF039 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location16959679-16964607 bp(+) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) CAACATC to CAACATCTCATGATGCACCTGCTTTAACATC at 16961444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
Predicted Effect probably benign
Transcript: ENSMUST00000038163
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141

DomainStartEndE-ValueType
Pfam:PNMA 5 364 6.9e-108 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,918 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cd276 G A 9: 58,535,504 R223C probably damaging Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dcdc2b GCTGC GCTGCCAGGTCTGC 4: 129,609,651 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml6 CTAAAAAAACAAAACA C 11: 29,752,551 probably benign Het
Eps8 C CTCAT 6: 137,517,070 probably null Het
Exd2 CACAGCCA C 12: 80,475,941 probably null Het
Gab3 TTC TTCGTC X: 75,000,004 probably benign Het
Gm10718 ATTTTCAGTTTCCTCGCCATATTCCAGGTCCTACAGTGTGCATTTCTCATTTTTCACGTTTTTCAGT ATTTTCAGT 9: 3,024,385 probably null Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,758 probably benign Het
Gm8369 GTG GTGTTTTTG 19: 11,511,782 probably benign Het
Igf1r GG GGTGATGGAGCTTG 7: 68,226,176 probably benign Het
Il2 GG GGGCTTGTTGTGTG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCAACCGGCCAGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Lypd8 ACCAATCACCAAC ACCAATCACCAACTGTTCCCTCGCCTCTGTTTCCCCCCCAATCACCAAC 11: 58,390,231 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Map1a CCAGC CCAGCCCCAGCTCCAGCTCCAGCTCCAGCTACAGC 2: 121,306,304 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Nefh AGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC AGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,007 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAGA G 19: 47,113,455 probably null Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGTTCCTGTAGAGCAATGGGGTTTC 5: 90,608,939 probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCCCCATGATCACTGTGCTC 15: 76,614,870 probably benign Het
Slc39a4 TC TCATCGTGATCACCATGGTCACCATGATCACTGTGGAC 15: 76,614,871 probably benign Het
Strn TTACCCC TTACCCCTGGCCGTGCTCCCTTACCCCAGTCCGTGCGCCCGTACCCC 17: 78,677,278 probably null Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,095 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,110 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Thegl GCGATCCTCCCCAGTCCCGCAAGGCCA GCGATCCTCCCCAGGCCCGCAAGGCCACCGATCCTCCCCAGTCCCGCAAGGCCA 5: 77,016,402 probably benign Het
Tmem28 CCG CCGCCGGCG X: 99,821,372 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGG CCCCAGGACTCCCTGTGCCCAACGGAACAAACCCAGGACTCCCTGTGCCCAACGG 15: 78,967,036 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zc3h4 TGACATGCACCCTGACATGCACCCAGACATGCACCCCGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA TGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA 7: 16,429,618 probably benign Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R1426:Pnmal1 UTSW 7 16960984 missense possibly damaging 0.56
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R2404:Pnmal1 UTSW 7 16960391 missense probably damaging 1.00
R3415:Pnmal1 UTSW 7 16960954 missense possibly damaging 0.74
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
R7756:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R7758:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
RF007:Pnmal1 UTSW 7 16961424 small insertion probably benign
RF009:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF020:Pnmal1 UTSW 7 16961451 small insertion probably benign
RF022:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF029:Pnmal1 UTSW 7 16961444 nonsense probably null
RF041:Pnmal1 UTSW 7 16961444 nonsense probably null
RF046:Pnmal1 UTSW 7 16961423 small insertion probably benign
RF047:Pnmal1 UTSW 7 16961423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAGATCAAGATGGTGGACCG -3'
(R):5'- ATAATCCTCACCTGGGAGGG -3'

Sequencing Primer
(F):5'- AAAGCCATGACCTGGGC -3'
(R):5'- CTCACCTGGGAGGGTAGCTTG -3'
Posted On2019-12-04