Incidental Mutation 'RF039:Gm10718'
ID604716
Institutional Source Beutler Lab
Gene Symbol Gm10718
Ensembl Gene ENSMUSG00000095186
Gene Namepredicted gene 10718
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #RF039 (G1)
Quality Score214.458
Status Not validated
Chromosome9
Chromosomal Location3023547-3025218 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ATTTTCAGTTTCCTCGCCATATTCCAGGTCCTACAGTGTGCATTTCTCATTTTTCACGTTTTTCAGT to ATTTTCAGT at 3024385 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099051] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179272] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000075573
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,918 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Cckbr GCA G 7: 105,434,686 probably null Het
Cd276 G A 9: 58,535,504 R223C probably damaging Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dcdc2b GCTGC GCTGCCAGGTCTGC 4: 129,609,651 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml6 CTAAAAAAACAAAACA C 11: 29,752,551 probably benign Het
Eps8 C CTCAT 6: 137,517,070 probably null Het
Exd2 CACAGCCA C 12: 80,475,941 probably null Het
Gab3 TTC TTCGTC X: 75,000,004 probably benign Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,758 probably benign Het
Gm8369 GTG GTGTTTTTG 19: 11,511,782 probably benign Het
Igf1r GG GGTGATGGAGCTTG 7: 68,226,176 probably benign Het
Il2 GG GGGCTTGTTGTGTG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCAACCGGCCAGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Lypd8 ACCAATCACCAAC ACCAATCACCAACTGTTCCCTCGCCTCTGTTTCCCCCCCAATCACCAAC 11: 58,390,231 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Map1a CCAGC CCAGCCCCAGCTCCAGCTCCAGCTCCAGCTACAGC 2: 121,306,304 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Nefh AGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC AGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,007 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAGA G 19: 47,113,455 probably null Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTTAACATC 7: 16,961,444 probably benign Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGTTCCTGTAGAGCAATGGGGTTTC 5: 90,608,939 probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCCCCATGATCACTGTGCTC 15: 76,614,870 probably benign Het
Slc39a4 TC TCATCGTGATCACCATGGTCACCATGATCACTGTGGAC 15: 76,614,871 probably benign Het
Strn TTACCCC TTACCCCTGGCCGTGCTCCCTTACCCCAGTCCGTGCGCCCGTACCCC 17: 78,677,278 probably null Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,095 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,110 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Thegl GCGATCCTCCCCAGTCCCGCAAGGCCA GCGATCCTCCCCAGGCCCGCAAGGCCACCGATCCTCCCCAGTCCCGCAAGGCCA 5: 77,016,402 probably benign Het
Tmem28 CCG CCGCCGGCG X: 99,821,372 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGG CCCCAGGACTCCCTGTGCCCAACGGAACAAACCCAGGACTCCCTGTGCCCAACGG 15: 78,967,036 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zc3h4 TGACATGCACCCTGACATGCACCCAGACATGCACCCCGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA TGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA 7: 16,429,618 probably benign Het
Other mutations in Gm10718
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01865:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01867:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01868:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01869:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01870:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01871:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01874:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01877:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01878:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01879:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01880:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01881:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01883:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01884:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01885:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01886:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01887:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01888:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01890:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01891:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01894:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01895:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01896:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01897:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01898:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01901:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01903:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01904:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01905:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01908:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01909:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01910:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01912:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01917:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01918:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01919:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01920:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01924:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01925:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01926:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01928:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01929:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01932:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01933:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01934:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01937:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01938:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01941:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01944:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01945:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01946:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01947:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01949:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01950:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01951:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01952:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01953:Gm10718 APN 9 3025118 missense probably benign 0.00
IGL01958:Gm10718 APN 9 3025118 missense probably benign 0.00
PIT4131001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
PIT4142001:Gm10718 UTSW 9 3024417 missense probably benign 0.01
R4567:Gm10718 UTSW 9 3023716 missense probably benign 0.01
R4850:Gm10718 UTSW 9 3023716 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGTCCTACAGTGTGCATTTCTC -3'
(R):5'- TTCCACTGTAGGACATGGAATATAGC -3'

Sequencing Primer
(F):5'- TCACGTTTTTCAGTGATTTCGAC -3'
(R):5'- ATGCACACTGTAGGACCTGG -3'
Posted On2019-12-04