Incidental Mutation 'RF040:Olfr418'
ID604749
Institutional Source Beutler Lab
Gene Symbol Olfr418
Ensembl Gene ENSMUSG00000049605
Gene Nameolfactory receptor 418
SynonymsGA_x6K02T2P20D-20826777-20827719, MOR267-8, GA_x6K02T2R7CC-581296-580364, Olfr418-ps1, Olfr1403, MOR267-12P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #RF040 (G1)
Quality Score217.468
Status Not validated
Chromosome1
Chromosomal Location173266001-173273994 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGACATC to G at 173270709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
Predicted Effect probably null
Transcript: ENSMUST00000059754
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213420
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Olfr418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01418:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01930:Olfr418 APN 1 173270610 missense probably benign
IGL01963:Olfr418 APN 1 173270352 missense probably damaging 0.99
IGL02104:Olfr418 APN 1 173271036 missense probably damaging 0.96
IGL02192:Olfr418 APN 1 173270850 missense probably damaging 1.00
IGL02256:Olfr418 APN 1 173270627 missense probably benign 0.04
IGL02340:Olfr418 APN 1 173270405 missense probably benign 0.10
IGL02454:Olfr418 APN 1 173270940 missense probably damaging 0.99
IGL02638:Olfr418 APN 1 173270331 missense probably benign 0.07
FR4737:Olfr418 UTSW 1 173270630 frame shift probably null
FR4976:Olfr418 UTSW 1 173270630 frame shift probably null
R0552:Olfr418 UTSW 1 173270805 missense probably benign 0.05
R0621:Olfr418 UTSW 1 173270675 missense possibly damaging 0.48
R0735:Olfr418 UTSW 1 173271002 missense probably benign 0.05
R1506:Olfr418 UTSW 1 173270769 missense probably benign 0.04
R1670:Olfr418 UTSW 1 173270900 missense probably damaging 1.00
R2111:Olfr418 UTSW 1 173270312 missense probably benign
R2204:Olfr418 UTSW 1 173270136 splice site probably null
R4475:Olfr418 UTSW 1 173270913 missense probably damaging 0.99
R4909:Olfr418 UTSW 1 173270979 missense probably damaging 0.97
R5457:Olfr418 UTSW 1 173270574 missense probably benign 0.00
R6124:Olfr418 UTSW 1 173270279 missense probably damaging 1.00
R6456:Olfr418 UTSW 1 173270538 missense probably damaging 1.00
R7220:Olfr418 UTSW 1 173270244 missense possibly damaging 0.56
R7240:Olfr418 UTSW 1 173270994 missense probably benign 0.27
R7672:Olfr418 UTSW 1 173270873 missense probably benign 0.18
R8073:Olfr418 UTSW 1 173270985 missense probably benign 0.42
R8116:Olfr418 UTSW 1 173270480 missense possibly damaging 0.88
RF032:Olfr418 UTSW 1 173270709 frame shift probably null
RF036:Olfr418 UTSW 1 173270709 frame shift probably null
X0019:Olfr418 UTSW 1 173270557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGATGGGATATGATCGCTATGTAGC -3'
(R):5'- TGGATGATGACCACCGTGAG -3'

Sequencing Primer
(F):5'- GATCGCTATGTAGCTATCTGCAAC -3'
(R):5'- GCACAGGTGGCAAAGGC -3'
Posted On2019-12-04