Incidental Mutation 'RF040:Tmem59'
ID604759
Institutional Source Beutler Lab
Gene Symbol Tmem59
Ensembl Gene ENSMUSG00000028618
Gene Nametransmembrane protein 59
Synonyms3110046P06Rik, thymic dendritic cell-derived factor 1, D4Ertd20e, 1110001M20Rik, MTDCF1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #RF040 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location107178399-107200996 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TTTGTTT to TTTGTTTGGTTGTTT at 107190526 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030361] [ENSMUST00000106753] [ENSMUST00000128123] [ENSMUST00000154007]
Predicted Effect probably benign
Transcript: ENSMUST00000030361
SMART Domains Protein: ENSMUSP00000030361
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:BSMAP 72 256 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106753
SMART Domains Protein: ENSMUSP00000102364
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 32 189 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128123
SMART Domains Protein: ENSMUSP00000120288
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
Pfam:BSMAP 18 127 1.7e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154007
SMART Domains Protein: ENSMUSP00000119701
Gene: ENSMUSG00000028618

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein shown to regulate autophagy in response to bacterial infection. This protein may also regulate the retention of amyloid precursor protein (APP) in the Golgi apparatus through its control of APP glycosylation. Overexpression of this protein has been found to promote apoptosis in a glioma cell line. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele display reduced dendritic arborization, reduced miniature excitatory postsynaptic currents, and impaired memory formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Tmem59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02663:Tmem59 APN 4 107197541 missense probably damaging 1.00
IGL02695:Tmem59 APN 4 107193314 missense probably benign 0.00
IGL02699:Tmem59 APN 4 107192538 missense probably benign 0.01
IGL02937:Tmem59 APN 4 107197585 missense probably damaging 1.00
R0945:Tmem59 UTSW 4 107187725 splice site probably benign
R2080:Tmem59 UTSW 4 107178774 missense probably damaging 0.99
R4621:Tmem59 UTSW 4 107190718 intron probably benign
R4622:Tmem59 UTSW 4 107190718 intron probably benign
R4623:Tmem59 UTSW 4 107190718 intron probably benign
R4819:Tmem59 UTSW 4 107187681 nonsense probably null
R5413:Tmem59 UTSW 4 107200462 missense probably benign 0.00
R5866:Tmem59 UTSW 4 107190557 missense probably damaging 0.99
R6073:Tmem59 UTSW 4 107193401 splice site probably null
RF031:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF033:Tmem59 UTSW 4 107190528 critical splice acceptor site probably benign
RF035:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF041:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF044:Tmem59 UTSW 4 107190532 critical splice acceptor site probably benign
RF060:Tmem59 UTSW 4 107190526 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGGGTACTCAAATTCACC -3'
(R):5'- TGCCAAGACCCTCATGTAAG -3'

Sequencing Primer
(F):5'- GGTACTCAAATTCACCAAACACTTTC -3'
(R):5'- GTAAGACATGACATTGACTATTGCTG -3'
Posted On2019-12-04