Incidental Mutation 'RF040:Pdik1l'
ID604760
Institutional Source Beutler Lab
Gene Symbol Pdik1l
Ensembl Gene ENSMUSG00000050890
Gene NamePDLIM1 interacting kinase 1 like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF040 (G1)
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location134275002-134287895 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) AC to ACCACCGC at 134279515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061234] [ENSMUST00000105876] [ENSMUST00000105877] [ENSMUST00000127857] [ENSMUST00000145006]
Predicted Effect probably benign
Transcript: ENSMUST00000061234
SMART Domains Protein: ENSMUSP00000060381
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105876
SMART Domains Protein: ENSMUSP00000101502
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 106 3e-8 PFAM
Pfam:Pkinase 8 328 2.2e-52 PFAM
Pfam:Pkinase_Tyr 99 329 5.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105877
SMART Domains Protein: ENSMUSP00000101503
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 84 184 2.2e-7 PFAM
Pfam:Pkinase 84 402 4.5e-51 PFAM
Pfam:Pkinase_Tyr 185 405 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127857
SMART Domains Protein: ENSMUSP00000117719
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase 8 113 3.4e-12 PFAM
Pfam:Pkinase_Tyr 8 136 8.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145006
SMART Domains Protein: ENSMUSP00000118116
Gene: ENSMUSG00000050890

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 185 4.1e-24 PFAM
Pfam:Pkinase 10 187 4.9e-38 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Pdik1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02439:Pdik1l APN 4 134278704 missense probably benign 0.11
FR4304:Pdik1l UTSW 4 134279374 frame shift probably null
FR4340:Pdik1l UTSW 4 134279512 intron probably benign
FR4342:Pdik1l UTSW 4 134279509 intron probably benign
FR4548:Pdik1l UTSW 4 134279512 intron probably benign
FR4589:Pdik1l UTSW 4 134279368 frame shift probably null
FR4589:Pdik1l UTSW 4 134279369 frame shift probably null
FR4737:Pdik1l UTSW 4 134279367 frame shift probably null
FR4737:Pdik1l UTSW 4 134279506 intron probably benign
FR4976:Pdik1l UTSW 4 134279506 intron probably benign
R1867:Pdik1l UTSW 4 134278911 missense probably damaging 1.00
R2106:Pdik1l UTSW 4 134284254 missense probably damaging 1.00
R2303:Pdik1l UTSW 4 134284248 nonsense probably null
R2398:Pdik1l UTSW 4 134278399 missense probably benign 0.01
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R3162:Pdik1l UTSW 4 134284250 missense probably damaging 1.00
R4515:Pdik1l UTSW 4 134278896 missense probably damaging 1.00
R4711:Pdik1l UTSW 4 134278990 missense probably benign 0.15
R5602:Pdik1l UTSW 4 134284269 missense probably damaging 0.99
R5822:Pdik1l UTSW 4 134287163 missense possibly damaging 0.53
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R6031:Pdik1l UTSW 4 134279041 missense probably damaging 0.98
R7517:Pdik1l UTSW 4 134278425 missense possibly damaging 0.83
R7705:Pdik1l UTSW 4 134279493 missense unknown
R8203:Pdik1l UTSW 4 134279365 missense unknown
RF002:Pdik1l UTSW 4 134279375 frame shift probably null
RF007:Pdik1l UTSW 4 134279368 frame shift probably null
RF008:Pdik1l UTSW 4 134279511 intron probably benign
RF022:Pdik1l UTSW 4 134279367 frame shift probably null
RF025:Pdik1l UTSW 4 134286594 frame shift probably null
RF026:Pdik1l UTSW 4 134286594 intron probably benign
RF030:Pdik1l UTSW 4 134279516 intron probably benign
RF031:Pdik1l UTSW 4 134279374 frame shift probably null
RF034:Pdik1l UTSW 4 134279374 frame shift probably null
RF035:Pdik1l UTSW 4 134279510 intron probably benign
RF048:Pdik1l UTSW 4 134279372 frame shift probably null
RF056:Pdik1l UTSW 4 134279502 intron probably benign
RF056:Pdik1l UTSW 4 134279516 intron probably benign
RF057:Pdik1l UTSW 4 134279368 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGTTTAAGATGCACAGAGGTTG -3'
(R):5'- ATCTCTGAGTTCGAGGCCAG -3'

Sequencing Primer
(F):5'- CTCAGGTCCTCAATAAGCATGGTG -3'
(R):5'- CCAGCCTGGTCTATAAAGTGAGTTC -3'
Posted On2019-12-04