Incidental Mutation 'RF040:Luzp1'
ID604761
Institutional Source Beutler Lab
Gene Symbol Luzp1
Ensembl Gene ENSMUSG00000001089
Gene Nameleucine zipper protein 1
SynonymsLuzp, 2700072H04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #RF040 (G1)
Quality Score214.458
Status Not validated
Chromosome4
Chromosomal Location136469761-136554780 bp(+) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) A to AGGTGGCCTCTTCAGC at 136543196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000063021] [ENSMUST00000105849] [ENSMUST00000129230] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably benign
Transcript: ENSMUST00000001116
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000063021
SMART Domains Protein: ENSMUSP00000060619
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000105849
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000129230
SMART Domains Protein: ENSMUSP00000128591
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
coiled coil region 11 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably benign
Transcript: ENSMUST00000170102
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Gene inactivation causes defective neural tube closure (exencephaly) and massive apoptosis in the hindbrain. Despite the incomplete penetrance of NTD, all homozygotes die perinatally due to complex cardiovascular anomalies. Other defects include an eyelid fusion defect, omphalocele and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Luzp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Luzp1 APN 4 136542776 missense probably damaging 1.00
IGL01766:Luzp1 APN 4 136542773 missense possibly damaging 0.92
IGL01868:Luzp1 APN 4 136542737 missense probably damaging 1.00
IGL03230:Luzp1 APN 4 136542878 missense probably benign 0.02
FR4548:Luzp1 UTSW 4 136543188 small insertion probably benign
FR4737:Luzp1 UTSW 4 136543196 small insertion probably benign
R0106:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R0674:Luzp1 UTSW 4 136543457 missense possibly damaging 0.85
R0676:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R1103:Luzp1 UTSW 4 136540730 missense possibly damaging 0.87
R1541:Luzp1 UTSW 4 136543325 missense probably damaging 1.00
R1812:Luzp1 UTSW 4 136542331 missense probably benign 0.03
R3924:Luzp1 UTSW 4 136542857 missense probably damaging 1.00
R4022:Luzp1 UTSW 4 136542193 missense probably benign 0.02
R4449:Luzp1 UTSW 4 136540863 missense probably damaging 1.00
R4976:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5119:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5411:Luzp1 UTSW 4 136543342 missense possibly damaging 0.59
R5659:Luzp1 UTSW 4 136542476 missense probably damaging 1.00
R5765:Luzp1 UTSW 4 136541029 missense probably damaging 0.98
R5828:Luzp1 UTSW 4 136540682 missense probably damaging 1.00
R6059:Luzp1 UTSW 4 136541480 missense probably benign 0.35
R6147:Luzp1 UTSW 4 136541063 missense probably damaging 1.00
R6181:Luzp1 UTSW 4 136543267 missense probably benign 0.01
R6200:Luzp1 UTSW 4 136541266 missense probably benign 0.12
R6368:Luzp1 UTSW 4 136541780 missense probably benign 0.24
R6581:Luzp1 UTSW 4 136540631 missense probably damaging 1.00
R6695:Luzp1 UTSW 4 136545298 missense possibly damaging 0.83
R6932:Luzp1 UTSW 4 136540813 nonsense probably null
R6998:Luzp1 UTSW 4 136543444 missense probably damaging 1.00
R7529:Luzp1 UTSW 4 136540932 missense probably damaging 1.00
R7878:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R8077:Luzp1 UTSW 4 136543091 missense probably damaging 1.00
R8154:Luzp1 UTSW 4 136541884 missense possibly damaging 0.47
R8292:Luzp1 UTSW 4 136542453 missense probably benign 0.01
RF028:Luzp1 UTSW 4 136543196 small insertion probably benign
RF033:Luzp1 UTSW 4 136543196 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTAGCAACCATGTCAGCTCCC -3'
(R):5'- CCTGTTCAGATGGCTGTGAC -3'

Sequencing Primer
(F):5'- TTCATAAACATGACATCACCTTGCAG -3'
(R):5'- ACCTGGGCTGCTCAAGTTCTAAG -3'
Posted On2019-12-04