Incidental Mutation 'RF040:Dnajc2'
ID604763
Institutional Source Beutler Lab
Gene Symbol Dnajc2
Ensembl Gene ENSMUSG00000029014
Gene NameDnaJ heat shock protein family (Hsp40) member C2
SynonymsMIDA1, Zrf1, Mida1, Zrf2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #RF040 (G1)
Quality Score100.457
Status Not validated
Chromosome5
Chromosomal Location21757267-21785251 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TAGTTG to T at 21757697 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030771] [ENSMUST00000030882] [ENSMUST00000115193] [ENSMUST00000115195]
Predicted Effect probably benign
Transcript: ENSMUST00000030771
SMART Domains Protein: ENSMUSP00000030771
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
low complexity region 231 245 N/A INTRINSIC
low complexity region 281 319 N/A INTRINSIC
Pfam:RAC_head 339 430 2.8e-24 PFAM
SANT 450 509 6.64e-10 SMART
SANT 550 602 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030882
SMART Domains Protein: ENSMUSP00000030882
Gene: ENSMUSG00000029017

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Peptidase_M16 68 215 6.1e-59 PFAM
Pfam:Peptidase_M16_C 220 404 4.1e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115193
SMART Domains Protein: ENSMUSP00000110847
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
DnaJ 87 153 2.16e-18 SMART
coiled coil region 230 358 N/A INTRINSIC
coiled coil region 404 445 N/A INTRINSIC
SANT 450 509 6.64e-10 SMART
SANT 550 602 1.34e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115195
SMART Domains Protein: ENSMUSP00000110849
Gene: ENSMUSG00000029014

DomainStartEndE-ValueType
DnaJ 13 79 2.16e-18 SMART
coiled coil region 156 284 N/A INTRINSIC
coiled coil region 330 371 N/A INTRINSIC
SANT 376 435 6.64e-10 SMART
SANT 476 528 2.4e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141022
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Dnajc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Dnajc2 APN 5 21774976 missense possibly damaging 0.83
IGL01479:Dnajc2 APN 5 21757893 missense probably damaging 1.00
IGL01804:Dnajc2 APN 5 21757363 missense probably damaging 1.00
IGL02478:Dnajc2 APN 5 21776790 missense probably damaging 1.00
IGL02552:Dnajc2 APN 5 21783063 missense probably damaging 1.00
IGL02657:Dnajc2 APN 5 21770481 splice site probably benign
IGL02832:Dnajc2 APN 5 21760410 missense probably benign
IGL03177:Dnajc2 APN 5 21775081 splice site probably benign
R1914:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R1915:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R2024:Dnajc2 UTSW 5 21776790 missense probably damaging 1.00
R2437:Dnajc2 UTSW 5 21760391 missense probably benign 0.06
R4177:Dnajc2 UTSW 5 21757396 missense probably benign 0.28
R4451:Dnajc2 UTSW 5 21757794 missense possibly damaging 0.93
R4812:Dnajc2 UTSW 5 21763486 missense probably benign 0.03
R4916:Dnajc2 UTSW 5 21757340 missense probably damaging 1.00
R5013:Dnajc2 UTSW 5 21757773 nonsense probably null
R5094:Dnajc2 UTSW 5 21776732 missense probably damaging 1.00
R5124:Dnajc2 UTSW 5 21763484 missense probably benign
R5891:Dnajc2 UTSW 5 21761711 missense possibly damaging 0.67
R6192:Dnajc2 UTSW 5 21768648 missense probably damaging 1.00
R6567:Dnajc2 UTSW 5 21766678 missense probably damaging 1.00
R7211:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7216:Dnajc2 UTSW 5 21776779 missense probably damaging 1.00
R7418:Dnajc2 UTSW 5 21760624 critical splice donor site probably null
R7728:Dnajc2 UTSW 5 21770540 missense possibly damaging 0.62
R7877:Dnajc2 UTSW 5 21760639 missense possibly damaging 0.88
R8156:Dnajc2 UTSW 5 21781319 critical splice donor site probably null
R8231:Dnajc2 UTSW 5 21761691 missense probably benign 0.00
R8360:Dnajc2 UTSW 5 21757707 missense unknown
X0027:Dnajc2 UTSW 5 21773811 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATCCTAGGCTACACAGTGAG -3'
(R):5'- CACAAATTTGTCTCAAACAGGTCC -3'

Sequencing Primer
(F):5'- AGGCTACACAGTGAGCTCTTATTC -3'
(R):5'- AGGTCCCTGCATAGATTCCAC -3'
Posted On2019-12-04