Incidental Mutation 'RF040:Tgoln1'
ID 604766
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Name trans-golgi network protein
Synonyms TGN38A, Ttgn1, D6Ertd384e, TGN38
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # RF040 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 72585415-72593983 bp(-) (GRCm39)
Type of Mutation small insertion (8 aa in frame mutation)
DNA Base Change (assembly) T to TCACCTCCCGTGGTCTTGCCAGAAG at 72593057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
AlphaFold Q62313
Predicted Effect probably benign
Transcript: ENSMUST00000070524
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,891,298 (GRCm39) probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,891,311 (GRCm39) probably benign Het
Brme1 TG TGTCAGGGCAGCAGCAG 8: 84,894,204 (GRCm39) probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,485,210 (GRCm39) probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,129,716 (GRCm39) probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,750 (GRCm39) probably null Het
Dnajc2 TAGTTG T 5: 21,962,695 (GRCm39) probably null Het
Fgd6 ATT A 10: 93,880,187 (GRCm39) probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,981,143 (GRCm39) probably null Het
Gab3 CTT CTTTTT X: 74,043,633 (GRCm39) probably benign Het
Garin5a C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,149,945 (GRCm39) probably null Het
Garin5a GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,149,955 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gykl1 G A 18: 52,827,488 (GRCm39) R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,883,085 (GRCm39) probably benign Het
Kmt2e TTT TTTTCTT 5: 23,683,507 (GRCm39) probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,270,507 (GRCm39) probably benign Het
Mamld1 AACA AACAACA X: 70,162,420 (GRCm39) probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,875,749 (GRCm39) probably benign Het
Med12l AGC AGCCGC 3: 59,183,388 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,410 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,571 (GRCm39) probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,064,550 (GRCm39) probably null Het
Ncoa6 TGCAGC TGC 2: 155,263,651 (GRCm39) probably benign Het
Nlrp3 GGGTA G 11: 59,449,378 (GRCm39) probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,069,802 (GRCm39) probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Or52z15 ACTTGCTGATATCTT ACTT 7: 103,332,145 (GRCm39) probably null Het
Osmr TTCT TTCTTCT 15: 6,867,182 (GRCm39) probably benign Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Pdik1l AC ACCACCGC 4: 134,006,826 (GRCm39) probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,386,994 (GRCm39) probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 (GRCm39) probably benign Het
Ryr3 CTGA C 2: 112,740,869 (GRCm39) probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,499,066 (GRCm39) probably benign Het
Smarca2 GC GCCCCACC 19: 26,608,422 (GRCm39) probably benign Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,224,871 (GRCm39) probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 (GRCm39) probably benign Het
Tcof1 CT CTATT 18: 60,961,480 (GRCm39) probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,966,655 (GRCm39) probably benign Het
Tfeb AGC AGCCGC 17: 48,097,036 (GRCm39) probably benign Het
Tfeb GCA GCATCA 17: 48,097,037 (GRCm39) probably benign Het
Tfeb GCA GCAACA 17: 48,097,022 (GRCm39) probably benign Het
Tfeb CAG CAGGAG 17: 48,097,035 (GRCm39) probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,047,723 (GRCm39) probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,673,141 (GRCm39) probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,851,263 (GRCm39) probably benign Het
Xirp2 TT TTTAT 2: 67,355,888 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 109,682,733 (GRCm39) probably benign Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72,593,073 (GRCm39) missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72,593,235 (GRCm39) missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72,593,055 (GRCm39) missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72,591,096 (GRCm39) missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72,593,334 (GRCm39) small insertion probably benign
R0684:Tgoln1 UTSW 6 72,592,974 (GRCm39) missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72,591,068 (GRCm39) missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72,593,084 (GRCm39) missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72,592,653 (GRCm39) missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72,592,784 (GRCm39) missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72,592,664 (GRCm39) missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72,593,123 (GRCm39) missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72,593,018 (GRCm39) missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72,592,984 (GRCm39) missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72,593,028 (GRCm39) missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72,593,403 (GRCm39) missense unknown
R8277:Tgoln1 UTSW 6 72,593,838 (GRCm39) start gained probably benign
R8979:Tgoln1 UTSW 6 72,593,262 (GRCm39) missense probably benign 0.00
R9566:Tgoln1 UTSW 6 72,592,911 (GRCm39) missense probably benign 0.00
RF003:Tgoln1 UTSW 6 72,593,335 (GRCm39) nonsense probably null
RF023:Tgoln1 UTSW 6 72,593,063 (GRCm39) small insertion probably benign
RF028:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF037:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF042:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF057:Tgoln1 UTSW 6 72,593,052 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCAGATTCAGTTTTGGAAG -3'
(R):5'- TTTCCAGTAAGGCGGAATCTGG -3'

Sequencing Primer
(F):5'- CCCAGATTCAGTTTTGGAAGTAAGTG -3'
(R):5'- GAATCTGGGCCGCGGAC -3'
Posted On 2019-12-04