Incidental Mutation 'RF040:Heatr3'
ID604772
Institutional Source Beutler Lab
Gene Symbol Heatr3
Ensembl Gene ENSMUSG00000031657
Gene NameHEAT repeat containing 3
SynonymsC030036P15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #RF040 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location88137855-88172027 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TAT to TATTGAT at 88156457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034079] [ENSMUST00000121949]
Predicted Effect probably benign
Transcript: ENSMUST00000034079
SMART Domains Protein: ENSMUSP00000034079
Gene: ENSMUSG00000031657

DomainStartEndE-ValueType
Pfam:HEAT_EZ 41 106 2.5e-11 PFAM
Blast:ARM 111 171 2e-25 BLAST
Blast:ARM 172 215 1e-15 BLAST
low complexity region 357 366 N/A INTRINSIC
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121949
SMART Domains Protein: ENSMUSP00000112812
Gene: ENSMUSG00000031657

DomainStartEndE-ValueType
Blast:ARM 1 54 7e-20 BLAST
Blast:ARM 55 98 8e-16 BLAST
low complexity region 240 249 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in ribosomal protein transport and in the assembly of the 5S ribonucleoprotein particle (5S RNP). The encoded protein also may be involved in NOD2-mediated NF-kappaB signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Heatr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Heatr3 APN 8 88141739 missense possibly damaging 0.95
IGL00780:Heatr3 APN 8 88170940 missense probably benign 0.01
IGL01105:Heatr3 APN 8 88161893 missense probably benign 0.04
IGL01653:Heatr3 APN 8 88144617 missense probably benign
IGL02129:Heatr3 APN 8 88158271 splice site probably benign
IGL02145:Heatr3 APN 8 88144599 missense probably benign 0.40
IGL02177:Heatr3 APN 8 88156723 missense probably benign
IGL02309:Heatr3 APN 8 88167072 missense probably damaging 1.00
IGL02675:Heatr3 APN 8 88144557 missense possibly damaging 0.91
IGL03379:Heatr3 APN 8 88150110 missense probably benign 0.13
R0763:Heatr3 UTSW 8 88158241 missense probably damaging 1.00
R1244:Heatr3 UTSW 8 88141739 missense possibly damaging 0.95
R1883:Heatr3 UTSW 8 88144593 missense possibly damaging 0.95
R1988:Heatr3 UTSW 8 88150317 missense probably benign 0.02
R2043:Heatr3 UTSW 8 88147694 splice site probably benign
R2079:Heatr3 UTSW 8 88141776 missense probably damaging 0.99
R2402:Heatr3 UTSW 8 88144572 missense probably benign 0.33
R3916:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R3917:Heatr3 UTSW 8 88150371 critical splice donor site probably null
R4127:Heatr3 UTSW 8 88138311 missense probably damaging 0.99
R4182:Heatr3 UTSW 8 88171002 utr 3 prime probably benign
R4190:Heatr3 UTSW 8 88138260 unclassified probably benign
R4769:Heatr3 UTSW 8 88141783 critical splice donor site probably null
R6046:Heatr3 UTSW 8 88139954 missense probably damaging 1.00
R6073:Heatr3 UTSW 8 88138140 missense probably benign 0.01
R6888:Heatr3 UTSW 8 88170884 missense probably damaging 1.00
R7284:Heatr3 UTSW 8 88156774 missense possibly damaging 0.69
R8278:Heatr3 UTSW 8 88156733 missense possibly damaging 0.50
RF025:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
RF031:Heatr3 UTSW 8 88156457 critical splice acceptor site probably benign
RF033:Heatr3 UTSW 8 88156456 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GAACACAGTTAACAGAGATTTGCTC -3'
(R):5'- TCATCATCCGAGGGATCTGAGG -3'

Sequencing Primer
(F):5'- AGATTTGCTCTAGTGGACCAG -3'
(R):5'- CTGGGGTATCAAAGAAACTCCCATG -3'
Posted On2019-12-04