Incidental Mutation 'RF040:Nlrp3'
ID604778
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene NameNLR family, pyrin domain containing 3
SynonymsCias1, cryopyrin, Pypaf1, NALP3, Mmig1
Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #RF040 (G1)
Quality Score213.576
Status Not validated
Chromosome11
Chromosomal Location59541568-59566956 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GGGTA to G at 59558552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
Predicted Effect probably null
Transcript: ENSMUST00000079476
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101148
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,762,169 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59565116 missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59549535 missense probably benign
IGL02334:Nlrp3 APN 11 59565083 missense probably benign
IGL02417:Nlrp3 APN 11 59566023 unclassified probably benign
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Flogiston UTSW 11 59558448 missense probably benign 0.00
nd1 UTSW 11 59565974 missense probably benign 0.45
Nd14 UTSW 11 59555875 missense possibly damaging 0.89
Nd3 UTSW 11 59565974 missense probably benign 0.45
nd5 UTSW 11 59565879 missense probably benign 0.01
nd6 UTSW 11 59549354 missense probably damaging 1.00
nd7 UTSW 11 59555875 missense possibly damaging 0.89
Nd9 UTSW 11 59549354 missense probably damaging 1.00
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59549531 missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59555748 nonsense probably null
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59548566 missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59565192 missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59548446 missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59548086 missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59565066 missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59543003 splice site probably null
R7916:Nlrp3 UTSW 11 59551863 missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59548788 missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59549403 missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59551790 missense possibly damaging 0.47
RF031:Nlrp3 UTSW 11 59558552 frame shift probably null
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCAGGTACAGGTCTCCTAG -3'
(R):5'- ACAGAATCCTAGCTGTGTGC -3'

Sequencing Primer
(F):5'- AGAGATGGCACTGACCTTGTTCC -3'
(R):5'- AATCCTAGCTGTGTGCCTCATGAAG -3'
Posted On2019-12-04