Incidental Mutation 'RF040:Nlrp3'
ID 604778
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # RF040 (G1)
Quality Score 213.576
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GGGTA to G at 59449378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
AlphaFold Q8R4B8
Predicted Effect probably null
Transcript: ENSMUST00000079476
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101148
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik G GTGGCTGCTC 1: 82,891,311 (GRCm39) probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,891,298 (GRCm39) probably benign Het
Brme1 TG TGTCAGGGCAGCAGCAG 8: 84,894,204 (GRCm39) probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,485,210 (GRCm39) probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,129,716 (GRCm39) probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,152,942 (GRCm39) probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,462 (GRCm39) probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,465,750 (GRCm39) probably null Het
Dnajc2 TAGTTG T 5: 21,962,695 (GRCm39) probably null Het
Fgd6 ATT A 10: 93,880,187 (GRCm39) probably null Het
Flywch1 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT 17: 23,981,143 (GRCm39) probably null Het
Gab3 CTT CTTTTT X: 74,043,633 (GRCm39) probably benign Het
Garin5a GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,149,955 (GRCm39) probably null Het
Garin5a C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,149,945 (GRCm39) probably null Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Gykl1 G A 18: 52,827,488 (GRCm39) R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,883,085 (GRCm39) probably benign Het
Kmt2e TTT TTTTCTT 5: 23,683,507 (GRCm39) probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,270,507 (GRCm39) probably benign Het
Mamld1 AACA AACAACA X: 70,162,420 (GRCm39) probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,875,749 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,410 (GRCm39) probably benign Het
Med12l AGC AGCCGC 3: 59,183,388 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,571 (GRCm39) probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,064,550 (GRCm39) probably null Het
Ncoa6 TGCAGC TGC 2: 155,263,651 (GRCm39) probably benign Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,069,802 (GRCm39) probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Or52z15 ACTTGCTGATATCTT ACTT 7: 103,332,145 (GRCm39) probably null Het
Osmr TTCT TTCTTCT 15: 6,867,182 (GRCm39) probably benign Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Pdik1l AC ACCACCGC 4: 134,006,826 (GRCm39) probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,386,994 (GRCm39) probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 (GRCm39) probably benign Het
Ryr3 CTGA C 2: 112,740,869 (GRCm39) probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,373,055 (GRCm39) probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,499,066 (GRCm39) probably benign Het
Smarca2 GC GCCCCACC 19: 26,608,422 (GRCm39) probably benign Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,224,871 (GRCm39) probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 (GRCm39) probably benign Het
Tcof1 CT CTATT 18: 60,961,480 (GRCm39) probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,966,655 (GRCm39) probably benign Het
Tfeb AGC AGCCGC 17: 48,097,036 (GRCm39) probably benign Het
Tfeb GCA GCATCA 17: 48,097,037 (GRCm39) probably benign Het
Tfeb GCA GCAACA 17: 48,097,022 (GRCm39) probably benign Het
Tfeb CAG CAGGAG 17: 48,097,035 (GRCm39) probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,593,057 (GRCm39) probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,047,723 (GRCm39) probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,673,141 (GRCm39) probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,851,263 (GRCm39) probably benign Het
Xirp2 TT TTTAT 2: 67,355,888 (GRCm39) probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 109,682,733 (GRCm39) probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCAGGTACAGGTCTCCTAG -3'
(R):5'- ACAGAATCCTAGCTGTGTGC -3'

Sequencing Primer
(F):5'- AGAGATGGCACTGACCTTGTTCC -3'
(R):5'- AATCCTAGCTGTGTGCCTCATGAAG -3'
Posted On 2019-12-04