Incidental Mutation 'RF040:Flywch1'
ID604785
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene NameFLYWCH-type zinc finger 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF040 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location23752793-23771602 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTCCTGGTGT to CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT at 23762169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325] [ENSMUST00000226460]
Predicted Effect probably null
Transcript: ENSMUST00000045517
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086325
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226460
Predicted Effect probably null
Transcript: ENSMUST00000227120
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fam71e1 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA 7: 44,500,531 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rpgrip1 AGGAAGAGG AG 14: 52,149,537 probably null Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC 15: 76,614,866 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tcof1 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC 18: 60,833,583 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Trappc9 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 15: 72,801,292 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23763026 missense probably benign 0.01
IGL01843:Flywch1 APN 17 23760345 missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23763092 splice site probably null
IGL02586:Flywch1 APN 17 23755702 missense probably benign 0.04
IGL02870:Flywch1 APN 17 23755902 missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23760414 missense probably damaging 1.00
lubdub UTSW 17 23761059 missense possibly damaging 0.93
R0830:Flywch1 UTSW 17 23762370 missense probably benign 0.00
R1411:Flywch1 UTSW 17 23755824 missense probably damaging 1.00
R2044:Flywch1 UTSW 17 23762313 nonsense probably null
R2153:Flywch1 UTSW 17 23755650 missense probably benign 0.21
R2314:Flywch1 UTSW 17 23763026 missense probably benign 0.01
R2497:Flywch1 UTSW 17 23755711 missense probably benign 0.27
R3022:Flywch1 UTSW 17 23763108 missense probably benign 0.00
R3625:Flywch1 UTSW 17 23760201 splice site probably benign
R3691:Flywch1 UTSW 17 23763212 missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23760617 missense probably benign 0.16
R5321:Flywch1 UTSW 17 23756651 missense probably damaging 1.00
R7148:Flywch1 UTSW 17 23755675 missense probably benign 0.01
R7200:Flywch1 UTSW 17 23761059 missense possibly damaging 0.93
R7629:Flywch1 UTSW 17 23755770 missense probably benign 0.06
R8362:Flywch1 UTSW 17 23756708 missense probably damaging 1.00
RF003:Flywch1 UTSW 17 23762166 frame shift probably null
RF007:Flywch1 UTSW 17 23762164 frame shift probably null
RF007:Flywch1 UTSW 17 23762171 frame shift probably null
RF009:Flywch1 UTSW 17 23762161 frame shift probably null
RF010:Flywch1 UTSW 17 23762175 frame shift probably null
RF013:Flywch1 UTSW 17 23762175 frame shift probably null
RF018:Flywch1 UTSW 17 23762166 frame shift probably null
RF022:Flywch1 UTSW 17 23762167 frame shift probably null
RF027:Flywch1 UTSW 17 23762158 frame shift probably null
RF031:Flywch1 UTSW 17 23762158 frame shift probably null
RF038:Flywch1 UTSW 17 23762164 frame shift probably null
RF041:Flywch1 UTSW 17 23762161 frame shift probably null
RF041:Flywch1 UTSW 17 23762177 frame shift probably null
RF046:Flywch1 UTSW 17 23762169 frame shift probably null
RF046:Flywch1 UTSW 17 23762174 frame shift probably null
RF049:Flywch1 UTSW 17 23762171 frame shift probably null
RF058:Flywch1 UTSW 17 23762177 frame shift probably null
X0009:Flywch1 UTSW 17 23755655 small deletion probably benign
X0028:Flywch1 UTSW 17 23761095 missense probably damaging 1.00
Z1176:Flywch1 UTSW 17 23761009 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GAAAACTTGAAAGGCCCTAGGATC -3'
(R):5'- ACTGTCACCCACCTGAGAAG -3'

Sequencing Primer
(F):5'- TTGAAAGGCCCTAGGATCCCTTG -3'
(R):5'- CACCTGAGAAGGAGGGCCTG -3'
Posted On2019-12-04